Iliamna bakeri

(Jeps.) Wiggins · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Iliamna

At a glance

Occurrence records183

Data sources9

Biological traits9

DNA specimens5

eDNA detections5

Sources9 archives

Databases and archives Iliamna bakeri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility183 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF183 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Iliamna bakeri is an uncommon species of flowering plant in the mallow family known by the common names Baker's globe mallow and Baker's wild hollyhock. It is endemic to northeastern California and southeastern Oregon. It grows in the Southern Cascade Range and Modoc Plateau forests and woodlands on volcanic soils.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessvariable

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iliamna bakeri has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences6

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSAF271165.1 ↗673 bp

ACGT

TCGAAACCTGCCTAGCAGAACGACCCGTGAACGTGATATCAAACAACAAAACGAGGGGCGCGGATGCATCCTTGCCCCAAACCCCCTCGA …

Iliamna bakeri isolate 1McCloud internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS5

plant barcodefungal barcode

08Occurrence & distribution

Record type183 records

Wild obs. + sensor74

Museum / vouchered109

Range

Area of Occupancy AOO492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy11% within 1 km

≤100 m 8>10 km 66

74 georeferenced

Open the mapobservation + sensor74

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 1≤1 km 35≤10 km 19

55 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence109

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 26 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	16
Claremont, US	13
CASlocation not on record	7
Corvallis, US	7
Davis, US	7
Arcata, US	5
STNFlocation not on record	5
Santa Barbara, US	3
San Diego, US	3
Canadian Department of Agriculturelocation not on record	3
Northridge, US	2
Bronx, US	2
University of Stellenboschlocation not on record	2
San Luis Obispo, US	2
Riverside, US	1
Wuzhou, CN	1
KNFSClocation not on record	1
Boise, US	1
Moscow, US	1
Pullman, US	1
Los Angeles, US	1
KNFYlocation not on record	1
ASUlocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
Angwin, US	1
Ashland, US	1

26 institutions · 89 of 109 vouchered records shown · 20 without an institution code

09Environmental DNA5 detections

Where the DNA of Iliamna bakeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)