Ilex uraiensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Aquifoliales/Aquifoliaceae/Ilex

At a glance

Occurrence records432

Data sources7

Biological traits8

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Ilex uraiensis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility432 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF432 records

DNA & barcodingNCBIsequences

01Narrative

DEFAULTSORT Ilex uraiensis is a species of plant in the family Aquifoliaceae. It is endemic to Taiwan. Leaves and inflorescence Flower The fruit is red when ripe. Veins on the underside of leaf. Leaves alternate, dense. Young leaves are red. Plant in spring Bark Flowers remain on branches after withering.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height25 m

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment4

Climatesubtropical

Climberself-supporting

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Ilex uraiensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols1

Documented compounds1 total

Compound	Class	Amount	Source
Quercetin		present	LOTUS

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ilex uraiensis has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON758401.1 ↗672 bpChina

ACGT

TTGTCGATGCCTGCAAAGTAGACCCGGCGAACTCGTTAAAATATGCCTGGGGGTTTGAGAAGGGGTGCGCGAGCCCCCCTACACACTCCC …

Ilex uraiensis voucher 27 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK4rbcL3ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type432 records

Wild obs. + sensor329

Museum / vouchered81

Other22

Origin

Native15

Range

Area of Occupancy AOO656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 48≤1 km 25≤10 km 1>10 km 18

92 georeferenced · 237 without coordinates

Open the mapobservation + sensor329

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 3

4 georeferenced · 77 without coordinates

Open the institutions mapphysical evidence81

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Taipei, TW	27
Taipei, TW	16
TAIElocation not on record	15
National Museum of Natural Sciencelocation not on record	12
Taipei, TW	7
Fort Worth, US	1
University of Stellenboschlocation not on record	1

7 institutions · 79 of 81 vouchered records shown · 2 without an institution code