Ilex umbellulata

(Wall.) Loes. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Aquifoliales/Aquifoliaceae/Ilex

At a glance

Occurrence records141

Data sources8

Biological traits7

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Ilex umbellulata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility141 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF141 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 40

01Narrative

A red-whiskered bulbul feeds upon the ripening fruit of Ilex umbellulata Ilex umbellulata is an evergreen tree species related to holly, generally four to fifteen metres in height. It is found in Southeast Asia. This tree is most often found growing in forests.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment4

Climatesubtropical

Climberself-supporting

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ilex umbellulata has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSON758446.1 ↗681 bpChina

ACGT

TTGTCGATGCCTGCAAAGTAGACCCGGCGAACTTGTTATAAAATATGCCGGGGGGTTTGAGAAGGGGTGCGCGAGCCCCCCGACGCATTC …

Ilex umbellulata voucher XCL1758 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ilex umbellulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 401×CCDB · book-indian_vol1

CCDB · book-indian_vol1 — Mehra, P.N. & Khosla, P.K. 1969

n 202×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.

CCDB · book-ipcn67-71 — MEHRA, P.N., & P.K. KHOSLA. 1969. In IOPB chromosome number reports XX. Taxon 18: 213-221.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type141 records

Wild obs. + sensor1

Museum / vouchered136

Other4

Range

Area of Occupancy AOO116 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1>10 km 1

2 georeferenced · 134 without coordinates

Open the institutions mapphysical evidence136

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kunming, CN	41
Beijing, CN	36
Nanjing, CN	12
Wuhan, CN	8
Chengdu, CN	8
Guangzhou, CN	7
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	5
Yangling, CN	3
Paris, FR	1
Stockholm, SE	1
Bronx, US	1
Guangzhou, CN	1
Guilin, CN	1
Jinghong, CN	1
Cincinnati, US	1
Kew, GB	1
Shanghai, CN	1
South Kensington, GB	1
MSB-3349location not on record	1
Fort Worth, US	1

20 institutions · 132 of 136 vouchered records shown · 4 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)