Ilex rotunda
Thunb. · speciesAt a glance
Occurrence records2 821
Data sources10
Biological traits26
DNA specimens55
eDNA detections40
Sources10 archives
Databases and archives Ilex rotunda's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility2 821 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics55 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
WikidataWikimedia Foundationstructured facts↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources26 traits
Chemical compositionLOTUS · NPASS63 compounds
Occurrence & distributionGBIF2 821 records
Environmental DNA1 datasets · 2 countries40 detections
DNA & barcodingBOLD · NCBI55 specimens
01Narrative
Ilex rotunda — вид квіткових рослин з родини падубових.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology5
Leaf size1 870 mm²
Plant height50 m
Seed volume0.48 mm³
Seed volume max0.48 mm³
Seed volume min0.48 mm³
Life cycle & reproduction5
Deciduousnessevergreen
Dispersal typeanimal
Life formshrub or tree
Life spanperennial
Raunkiær life formphanerophyte
Diet & foraging1
Parasiteindependent
Habitat & environment7
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit fleshinessfleshy
Growth formtree
Woodinesswoody
Physiology & chemistry8
Leaf C:N ratio37.46 g/g
Leaf c480 mg/g
Leaf dry-matter content (LDMC)334 mg/g
Leaf n18.21 mg/g
Leaf p0.465 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)10.52 mm²/mg
Wood density555 mg/cm³
03Chemical composition63 compounds
Compounds documented for Ilex rotunda across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Ursane and Taraxastane triterpenoids28
Oleanane triterpenoids18
Menthane monoterpenoids4
Cinnamic acids and derivatives2
Miscellaneous apocarotenoids1
Documented compounds63 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Ursolic Acid | present | LOTUS | |
| (1R,2R,4aS,6aR,6aS,6bR,8aR,9R,10R,12aR,14bS)-1,10-dihydroxy-9-(hydroxymethyl)-1,2,6a,6b,9,12a-hexamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (1R,2R,4aS,6aR,6aS,6bR,8aR,9R,10S,12aR,14bS)-9-(hydroxymethyl)-1,6a,6b,9,12a-pentamethyl-10-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid | present | LOTUS | |
| (1R,2R,4aS,6aR,6aS,6bR,8aS,9R,10S,12aR,14bR)-1,10-dihydroxy-9-(hydroxymethyl)-1,2,6a,6b,9,12a-hexamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (1R,2R,4aS,6aS,6aS,6bR,8aS,9S,10S,12aR,14bR)-1,10-dihydroxy-9-(hydroxymethyl)-1,2,6a,6b,9,12a-hexamethyl-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (2R,3R,4R,5S,6S)-6-[[(3S,4R,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-4-(hydroxymethyl)-4,6a,6b,11,11,14b-hexamethyl-8a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3,4,5-trihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (2R,3S,4S,5R,6S)-2-(hydroxymethyl)-6-[4-[(Z)-3-hydroxyprop-1-enyl]-2,6-dimethoxyphenoxy]oxane-3,4,5-triol | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4aR,6aR,6bS,8aR,12S,12aS,14aR,14bR)-12-hydroxy-4,4,6a,6b,11,11,14b-heptamethyl-8a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3,4-dihydroxy-5-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4S,4aR,6aR,6bS,8aR,12S,12aS,14aR,14bR)-12-hydroxy-4-(hydroxymethyl)-4,6a,6b,11,11,14b-hexamethyl-8a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3,4,5-trihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(3S,4S,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-4-(hydroxymethyl)-4,6a,6b,11,11,14b-hexamethyl-8a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3,4,5-trihydroxyoxane-2-carboxylic acid | present | LOTUS |
05DNA & barcoding55 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ilex rotunda has left across the world's sequence archives.
At a glance
DNA specimens55
Marker genes6
GenBank sequences10
eDNA detections40
Countries2
The DNA barcodea real sequence read deposited for this species
AAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGAATTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTGGCAGC …
Ilex rotunda TF<JPN>:TW025631 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL10★ITS★ITS2trnH-psbA
animal barcodeplant barcodefungal barcodemarker
08Occurrence & distribution
Record type2 821 records
Wild obs. + sensor712
Museum / vouchered2 067
Cultivated / captive5
Fossil1
Other36
Origin
Native17
Range
Area of Occupancy AOO4 476 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy52% within 1 km
≤100 m 200≤1 km 38≤10 km 80>10 km 137
455 georeferenced · 257 without coordinates
Open the mapobservation + sensor712
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 5≤1 km 18≤10 km 34>10 km 3
60 georeferenced · 2 007 without coordinates
Open the institutions mapphysical evidence2 067
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 2
2 georeferenced · 3 without coordinates
Open the mapnot free-living5
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions63 of 105 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 360 |
| Guangzhou, CN | 255 |
| Guilin, CN | 190 |
| Nishihara, JP | 121 |
| National Museum of Natural Sciencelocation not on record | 96 |
| Taipei, TW | 76 |
| Chengdu, CN | 62 |
| Nanjing, CN | 60 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 56 |
| Odawara, JP | 55 |
| Kochi, JP | 33 |
| Kunming, CN | 32 |
| Sanda, JP | 31 |
| Nagano City, JP | 27 |
| Guangzhou, CN | 26 |
| Taipei, TW | 25 |
| Taipei, TW | 25 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 25 |
| Tsukuba, JP | 22 |
| Tokushima, JP | 19 |
| FFPRIlocation not on record | 19 |
| Yangling, CN | 19 |
| Wuhan, CN | 18 |
| TAIElocation not on record | 17 |
| Changsha, CN | 17 |
| Zhuzhou, CN | 15 |
| South China Normal Universitylocation not on record | 14 |
| Chiba, JP | 13 |
| SCAUlocation not on record | 12 |
| Forestry and Forest Products Research Institutelocation not on record | 12 |
| Elocation not on record | 12 |
| Central China Normal Universitylocation not on record | 12 |
| Seoul, KR | 11 |
| Shanghai, CN | 11 |
| Xiamen, CN | 11 |
| Osaka, JP | 10 |
| Shanghai, CN | 10 |
| National Institute of Biological Resourceslocation not on record | 10 |
| Cambridge, US | 9 |
| Fujian Institute of Subtropical Botanylocation not on record | 9 |
| Nishihara, JP | 8 |
| Hangzhou, CN | 7 |
| Nanjing, CN | 7 |
| Nagasaki University - Fisherieslocation not on record | 6 |
| J.F.Oberlin Universitylocation not on record | 6 |
| KR | 6 |
| Kyoto Universitylocation not on record | 6 |
| Bronx, US | 5 |
| Anhui Normal Universitylocation not on record | 5 |
| Chengdu, CN | 5 |
| Sendai, JP | 5 |
| Nanjing, CN | 5 |
| FJFClocation not on record | 5 |
| Sagamihara, JP | 4 |
| Guizhou Forestry Schoollocation not on record | 4 |
| Kagoshima, JP | 4 |
| Wuhan, CN | 4 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 4 |
| Zhejiang Universitylocation not on record | 4 |
| Saint Louis, US | 4 |
| Edinburgh, GB | 3 |
| Minia, EG | 3 |
| Zhejiang Museum of Natural Historylocation not on record | 3 |
| Toyama, JP | 3 |
| Hangzhou Normal Collegelocation not on record | 3 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 3 |
| Auckland, NZ | 2 |
| JGSlocation not on record | 2 |
| Central China Agricultural Universitylocation not on record | 2 |
| Miami, US | 2 |
| Guiyang, CN | 2 |
| Yunnan Universitylocation not on record | 2 |
| Guiyang, CN | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Beijing, CN | 2 |
| 黔东南州民族医药研究所标本室location not on record | 2 |
| Herbarium of the Kyushu University Museum (FU)location not on record | 2 |
| Angwin, US | 2 |
| Fort Worth, US | 2 |
| KURAlocation not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Burlington, US | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Xiangtan City, CN | 1 |
| Davis, US | 1 |
| Cincinnati, US | 1 |
| Bando, JP | 1 |
| Riverside, US | 1 |
| EL PASO, US | 1 |
| SJNAlocation not on record | 1 |
| Christchurch, NZ | 1 |
| JP | 1 |
| Peking Universitylocation not on record | 1 |
| Rotorua, NZ | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Paris, FR | 1 |
| FJIDClocation not on record | 1 |
| Lanzhou, CN | 1 |
| Chongqing Museumlocation not on record | 1 |
| Moscow State Universitylocation not on record | 1 |
| WNNUlocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Xian, CN | 1 |
105 institutions · 2 033 of 2 067 vouchered records shown · 33 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA40 detections
Where the DNA of Ilex rotunda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found40
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 40 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.8 °C 11.8–23.3
Seasonal swing summer↔winter19.0 °C
Max temp (day)21.7 °C 15.7–24.7
Min temp (night)16.7 °C 8.50–21.7
Precipitation236 mm/mo 191–530
Air humidity63.2 % 56.7–66.6
Moisture balance107 mm/mo
Vapour deficit842 Pa 652–1,010
Wind speed3.40 m/s
Cloud cover39.5 % 37.2–50.7
CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.