Ilex pernyi

Plantae/Tracheophyta/Magnoliopsida/Aquifoliales/Aquifoliaceae/Ilex

At a glance

Occurrence records1 309

Data sources10

Biological traits13

DNA specimens6

eDNA detections5

Sources10 archives

Databases and archives Ilex pernyi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 309 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS17 compounds

Occurrence & distributionGBIF1 309 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Ilex pernyi — вид квіткових рослин з родини падубових.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height8 m

Seed mass18.19 mg

Life cycle & reproduction3

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formtree

Woodinesswoody

Physiology & chemistry4

Leaf c469 mg/g

Leaf dry-matter content (LDMC)364 mg/g

Leaf n7.6 mg/g

Leaf p0.828 mg/g

Other traits1

Plant support typefree-standing

03Chemical composition17 compounds

Compounds documented for Ilex pernyi across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Oleanane triterpenoids5

Ursane and Taraxastane triterpenoids4

Flavonols2

Depsides1

Oleanane triterpenoids $ Ursane and Taraxastane triterpenoids1

Documented compounds17 total

Compound	Amount	Source
(+)-syringaresinol beta-D-glucoside	present	LOTUS
(1R,2S,3R,4aR,6aR,6aS,6bR,8aR,9R,10S,12aR,14bS)-10-hydroxy-9-(hydroxymethyl)-1,2,6a,6b,9,12a-hexamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid	present	LOTUS
(1R,2S,3R,4aR,6aR,6aS,6bR,8aR,9R,10S,12aR,14bS)-9-(hydroxymethyl)-1,2,6a,6b,9,12a-hexamethyl-3,10-bis[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]-2,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydro-1H-picene-4a-carboxylic acid	present	LOTUS
(1S,4aR,6aR,6aS,6bR,8aR,9R,10S,12aR,14bS)-10-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-1-hydroxy-9-(hydroxymethyl)-2,2,6a,6b,9,12a-hexamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid	present	LOTUS
(2-Carboxy-4-formyl-3,5-dihydroxyphenyl)methyl 3-formyl-2,4-dihydroxy-6-methylbenzoate	present	NPASS
(2S,3R,4S,5S,6R)-2-[(3R,6E,10S)-2,10-dihydroxy-2,6,10-trimethyldodeca-6,11-dien-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,3S,4R,5R,6R)-6-[[(3S,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-4,4,6a,6b,11,11,14b-heptamethyl-8a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-4,5-dihydroxy-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxane-2-carboxylic acid	present	LOTUS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one	present	LOTUS
3-O-beta-D-glucopyranosyl-(1->2)-O-alpha-L-arabinopyranosyl-3beta,19alpha,23-trihydroxy-urs-12-en-28-oic acid 28-O-alpha-L-rhamnopyranosyl-(1->2)-O-beta-D-glucopyranoside	present	LOTUS
butyl (2S,3S,4S,5R,6R)-6-[[(3S,4R,4aR,6aR,6bS,8aR,10R,11S,12R,12aS,14aR,14bR)-10-hydroxy-4-(hydroxymethyl)-4,6a,6b,11,12,14b-hexamethyl-8a-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-2,3,4a,5,6,7,8,9,10,11,12,12a,14,14a-tetradecahydro-1H-picen-3-yl]oxy]-3,4,5-trihydroxyoxane-2-carboxylate	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ilex pernyi has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences10

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ389234.1 ↗674 bp

ACGT

TTGTCGATGCCTGCAAAGTAGACCCGGCGAACTTGTTAAAATATGCCTGGGGGTTTGAGAAGGGGTGCGCGAGCCCCCCAACACACTCCC …

Ilex pernyi isolate M15 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matKrbcLITS10ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 309 records

Wild obs. + sensor2

Museum / vouchered1 290

Cultivated / captive9

Other8

Range

Area of Occupancy AOO676 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 1≤1 km 2≤10 km 3>10 km 1

7 georeferenced · 1 283 without coordinates

Open the institutions mapphysical evidence1 290

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced · 3 without coordinates

Open the mapnot free-living9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions39 of 58 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chengdu, CN	275
Beijing, CN	238
Yangling, CN	157
Wuhan, CN	121
Nanjing, CN	77
Guangzhou, CN	72
Chengdu, CN	66
Kunming, CN	50
Guilin, CN	31
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	17
Xian, CN	16
Shanghai, CN	14
Seoul, KR	14
Wuhan, CN	10
WNNUlocation not on record	10
Xian, CN	8
Xining, CN	7
Lanzhou, CN	7
Changsha, CN	7
Chongqing Natural History Museumlocation not on record	5
Shanghai, CN	5
Zhuzhou, CN	5
Southwest Forestry Collegelocation not on record	5
Central China Normal Universitylocation not on record	5
Tianjin Natural History Museumlocation not on record	4
Anhui Normal Universitylocation not on record	4
SCAUlocation not on record	4
Zhengzhou, CN	4
Central China Agricultural Universitylocation not on record	4
Chongqing, CN	3
Chengdu, CN	3
Rotorua, NZ	3
Nagasaki University - Fisherieslocation not on record	3
Taipei, TW	3
Hangzhou, CN	3
Taipei, TW	2
Vancouver, CA	2
Guiyang, CN	2
University of New Hampshirelocation not on record	2
Inner Mongolia Universitylocation not on record	2
Zhejiang Universitylocation not on record	2
South China Normal Universitylocation not on record	2
MAlocation not on record	1
Fujian Institute of Subtropical Botanylocation not on record	1
Nanchong, CN	1
Guangzhou, CN	1
Kew, GB	1
Mississippi State, US	1
Knoxville, US	1
Norfolk, US	1
Guiyang, CN	1
GJOlocation not on record	1
Uppsala, SE	1
Herbarium of South China Botanical Gardenlocation not on record	1
PRClocation not on record	1
Bangkok, TH	1
Christchurch, NZ	1
Bronx, US	1

58 institutions · 1 290 of 1 290 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Ilex pernyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 14.2–14.2

Seasonal swing summer↔winter21.3 °C

Max temp (day)17.1 °C

Min temp (night)9.60 °C

Precipitation138 mm/mo

Air humidity62.6 %

Moisture balance66.8 mm/mo

Vapour deficit664 Pa

Wind speed1.10 m/s

Cloud cover41.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources10 archives

Size & morphology2

Life cycle & reproduction3

Habitat & environment3

Physiology & chemistry4

Other traits1

Compound class profile5 classes

Documented compounds17 total

At a glance

Record type1 309 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions39 of 58 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 309 records