Ilex perado

Sol. ex Aiton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Aquifoliales/Aquifoliaceae/Ilex

At a glance

Occurrence records250

Data sources6

Biological traits39

DNA specimens2

eDNA detections42

Sources6 archives

Databases and archives Ilex perado's data was compiled from.

GBIFGlobal Biodiversity Information Facility250 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources39 traits

Occurrence & distributionGBIF250 records

Environmental DNA2 datasets · 3 countries42 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Fruit width max10 mm

Fruit width min8 mm

Leaf length max150 mm

Leaf length min100 mm

Leaf width max80 mm

Leaf width min50 mm

Plant height4.25 m

Plant height max20 m

Seed mass25 mg

Life cycle & reproduction13

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typeanimal

Flower colourwhite

Flowering endJun

Flowering startMar

Life formtree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Self fertilizationabsent

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max100 m

Elevation min950 m

Epiphyteterrestrial

Fruit colourred

Fruit typedrupe

Growth formtree

Leaf formovate

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density520 mg/cm³

Other traits3

Defenseyes

Plant support typefree-standing

Seeds per fruit>1000

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ilex perado has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections42

Countries3

The DNA barcodea real sequence read deposited for this species

ITSON758394.1 ↗666 bpUnited Kingdom

ACGT

TTGTCGATGCCTGCAAAGTAGACCCGGTGAACTTGTTAAAATATGCCTGGGGGTTTGGGAAGGGGTGCGCGAGCCCCCCAACACACTCCC …

Ilex perado voucher s.n. internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL3★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type250 records

Wild obs. + sensor200

Museum / vouchered44

Other6

Origin

Introduced1

Range

Area of Occupancy AOO452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 45≤1 km 89≤10 km 38>10 km 2

174 georeferenced · 26 without coordinates

Open the mapobservation + sensor200

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤1 km 14≤10 km 1

15 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	14
CICYTEXlocation not on record	14
Moscow State Universitylocation not on record	2
University of New Hampshirelocation not on record	1
ISAlocation not on record	1
MAlocation not on record	1
Wlocation not on record	1
LDlocation not on record	1
Universität Göttingenlocation not on record	1

9 institutions · 36 of 44 vouchered records shown · 8 without an institution code

09Environmental DNA42 detections

Where the DNA of Ilex perado was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 15.2–19.2

Seasonal swing summer↔winter18.6 °C

Max temp (day)24.2 °C 20.1–24.2

Min temp (night)14.1 °C 9.00–14.1

Precipitation91.3 mm/mo 33.4–91.3

Air humidity59.3 % 52.9–59.3

Moisture balance-4.20 mm/mo -61.7–-4.20

Vapour deficit909 Pa 909–953

Wind speed1.80 m/s 1.80–2.00

Cloud cover38.8 % 38.3–38.8

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)