Ilex longipes

Chapm. ex Trel. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Aquifoliales/Aquifoliaceae/Ilex

At a glance

Occurrence records295

Data sources9

Biological traits8

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Ilex longipes's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility295 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF295 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Ilex longipes, commonly called the Georgia holly, is a species of plant in the holly family. It is native to the southeastern United States, where it has a patchy distribution. It is typically found in upland forests. Ilex longipes is a large shrub or small tree. It produces small white flowers in the spring and red berries in the fall.Texas Native Plant Database It has a similar appearance to Ilex cuthbertii and Ilex decidua, which it is sometimes considered a variety of.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree, Shrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition2 compounds

Compounds documented for Ilex longipes across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Isorhamnetin		present	LOTUS
Quercetin		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ilex longipes has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSFJ394696.1 ↗690 bp

ACGT

TTGTCGATGCCTGCAAAGTAGACCGGCGAACTTGTTAAAATATGCTGGGGGTTTGAGAAAAGGGGGTGCGCGAGCCCCCCCCAACACACT …

Ilex longipes voucher S. Andrews SA1472 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type295 records

Wild obs. + sensor170

Museum / vouchered125

Range

Area of Occupancy AOO872 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 87≤1 km 13≤10 km 5>10 km 28

133 georeferenced · 37 without coordinates

Open the mapobservation + sensor170

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 8≤1 km 12≤10 km 30>10 km 6

56 georeferenced · 69 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jackson, US	18
Tuscaloosa, US	12
Little Rock, US	10
Philadelphia, US	8
US	7
Bronx, US	5
Mississippi State, US	5
Columbia, US	5
Austin, US	4
Chapel Hill, US	4
Wuzhou, CN	4
Burlington, US	4
Bloomington, US	4
University of Southern Mississippilocation not on record	3
Tall Timbers Research Stationlocation not on record	3
Chongqing Museumlocation not on record	3
Clemson, US	3
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	3
Fort Worth, US	3
James F. Matthews Center for Biodiversity Studieslocation not on record	2
Miami, US	2
Knoxville, US	2
Millersville, US	1
Tampa, US	1
Dekalb, US	1
Jena Microbial Resource Collectionlocation not on record	1
Saint Louis, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
AUAlocation not on record	1
Phoenix, US	1
Bangkok, TH	1
University of Tennessee at Chattanoogalocation not on record	1

32 institutions · 124 of 125 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Ilex longipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)