Ilex kaushue

S.Y.Hu · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Aquifoliales/Aquifoliaceae/Ilex

At a glance

Occurrence records28

Data sources11

Biological traits7

DNA specimens3

eDNA detections1

Sources11 archives

Databases and archives Ilex kaushue's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Chemical compositionLOTUS · NPASS179 compounds

Occurrence & distributionGBIF28 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Ilex kaushue is a species of plant in the holly family, Aquifoliaceae, which is used to make a very bitter tea called kuding. It is native to southern China and northern Vietnam, growing in dense forests, a tree up to 8 m tall.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height20 m

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment3

Climatesubtropical

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

03Chemical composition179 compounds

Compounds documented for Ilex kaushue across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Oleanane triterpenoids68

Ursane and Taraxastane triterpenoids21

Oleanane triterpenoids $ Ursane and Taraxastane triterpenoids14

Menthane monoterpenoids5

Cinnamic acids and derivatives4

Documented compounds179 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-trans-Carveol	present	NPASS
(1R,2R,3S,4R,6aS,6bR,12aR,14S)-1,2,3,4,6a,6b,9,9,12a-nonamethyl-3,4,4a,5,6,6a,7,8,8a,10,11,12,13,14-tetradecahydro-2H-picene-1,10,14-triol	present	LOTUS
(1R,2R,3S,4R,6aS,6bR,12aS)-1,2,3,4,6a,6b,9,9,12a-nonamethyl-3,4,4a,5,6,6a,7,8,8a,10,11,12-dodecahydro-2H-picene-1,10-diol	present	LOTUS
(1R,4R)-Dihydrocarvone	present	NPASS
(1R,4R,5R,8S,10R,13R,14S,19R,20R)-10-[(2R,3S,4S,5S)-4-[(2S,3S,4R,5R,6S)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-3-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-19-hydroxy-4,5,9,9,13,19,20-heptamethyl-21-oxahexacyclo[18.2.2.01,18.04,17.05,14.08,13]tetracosa-15,17-dien-22-one	present	LOTUS
(1R,4R,5S,8R,10S,13R,14S,15S,19R,20R)-15,19-dihydroxy-10-[(2S,3S,4S,5S)-5-hydroxy-4-[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-4,5,9,9,13,19,20-heptamethyl-21-oxahexacyclo[18.2.2.01,18.04,17.05,14.08,13]tetracos-17-en-22-one	present	LOTUS
(1R,4R,5S,8R,10S,13S,14R,15R,19R,20S)-10-[(2S,3R,4R,5R)-4-[(2S,3S,4R,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-3-[(2S,3R,4S,5S,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-15,19-dihydroxy-4,5,9,9,13,19,20-heptamethyl-21-oxahexacyclo[18.2.2.01,18.04,17.05,14.08,13]tetracos-17-en-22-one	present	LOTUS
(1R,4R,5S,8S,10S,13R,14S,18S,19S,20S)-10-[(2R,3R,4S,5S)-4-[(2S,3S,4S,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2R,3S,4R,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-5-hydroxy-3-[(2R,3S,4S,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-19-hydroxy-4,5,9,9,13,19,20-heptamethyl-21-oxahexacyclo[18.2.2.01,18.04,17.05,14.08,13]tetracos-16-en-22-one	present	LOTUS
(1R,4S,5R,8R,10R,13S,14R,16R,19S,20S)-10-[(2R,3R,4S,5R,6S)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2R,3R,4S,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-16,19-dihydroxy-4,5,9,9,13,19,20-heptamethyl-21-oxahexacyclo[18.2.2.01,18.04,17.05,14.08,13]tetracos-17-en-22-one	present	LOTUS
(1R,4S,5R,8R,10R,13S,14R,16R,19S,20S)-16,19-dihydroxy-10-[(2S,3R,4R,5S)-5-hydroxy-4-[(2R,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3-[(2S,3S,4S,5S,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-4,5,9,9,13,19,20-heptamethyl-21-oxahexacyclo[18.2.2.01,18.04,17.05,14.08,13]tetracos-17-en-22-one	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ilex kaushue has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSON758422.1 ↗673 bpChina

ACGT

TTGTCGATGCCTGCAAAGTAGACCCGGCGAACTTGTTAAAATATGCCTGGGGGTTTGAGAAGGGGTGCGCGAGCCCCCCGACACACTCCC …

Ilex kaushue voucher JXAU/cultivated internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type28 records

Museum / vouchered27

Other1

Range

Area of Occupancy AOO44 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 27 records without

Open the institutions mapphysical evidence27

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guilin, CN	18
Beijing, CN	3
Kunming, CN	2
Nanjing, CN	2
Guangzhou, CN	1
Herbarium of South China Botanical Gardenlocation not on record	1

6 institutions · 27 of 27 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Ilex kaushue was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 24.4–24.4

Seasonal swing summer↔winter17.4 °C

Max temp (day)28.6 °C

Min temp (night)19.2 °C

Precipitation213 mm/mo

Air humidity63.4 %

Moisture balance44.3 mm/mo

Vapour deficit1,116 Pa

Wind speed4.00 m/s

Cloud cover50.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)