Ilex asprella

(Hook. & Arn.) Champ. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Aquifoliales/Aquifoliaceae/Ilex

At a glance

Occurrence records3 055

Data sources10

Biological traits17

DNA specimens20

eDNA detections21

Sources10 archives

Databases and archives Ilex asprella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 055 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF3 055 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceGoaT · NCBI≈804 Mbp

01Narrative

Ilex asprella, also known as rough-leaved holly and plum-leaved holly, is a deciduous shrub native in South East Asia. Ilex asprella is one of the few deciduous species in the family Aquifoliaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology5

Leaf size912 mm²

Plant height2.5 m

Seed mass4.8 mg

Seed mass max4.8 mg

Seed mass min4.8 mg

Life cycle & reproduction4

Deciduousnessdeciduous

Dispersal typeanimal

Life formshrub

Life spanperennial

Habitat & environment3

Climatesubtropical

Growth formshrub

Woodinesswoody

Physiology & chemistry5

Leaf C:N ratio23.2 g/g

Leaf c468 mg/g

Leaf dry-matter content (LDMC)186 mg/g

Leaf n20.17 mg/g

Photosynthetic pathwayC3

03Chemical composition2 compounds

Compounds documented for Ilex asprella across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Oleanane triterpenoids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(3beta)-3,27-Bis(((2E)-3-(4-hydroxyphenyl)-1-oxo-2-propen-1-yl)oxy)olean-12-en-28-oic acid		present	LOTUS
Asprellic acid C		present	LOTUS

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ilex asprella has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes4

GenBank sequences7

eDNA detections21

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV368957.1 ↗409 bpChina · 2024

ACGT

ACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTT …

Ilex asprella voucher MC8 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL5★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ilex asprella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈804 071 636 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ilex asprella0.80 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type3 055 records

Wild obs. + sensor2 126

Museum / vouchered812

Other117

Range

Area of Occupancy AOO3 628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 1 170≤1 km 216≤10 km 45>10 km 40

1 471 georeferenced · 655 without coordinates

Open the mapobservation + sensor2 126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 809 without coordinates

Open the institutions mapphysical evidence812

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 46 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	160
Taipei, TW	107
Guangzhou, CN	87
Guilin, CN	42
Taipei, TW	39
Taipei, TW	36
Xiamen, CN	35
Nanjing, CN	33
Kunming, CN	32
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	20
Guangzhou, CN	18
Hangzhou, CN	18
Chengdu, CN	17
Nagasaki University - Fisherieslocation not on record	16
Shanghai, CN	14
FJFClocation not on record	13
Zhejiang Universitylocation not on record	11
FJIDClocation not on record	10
SCAUlocation not on record	9
Yangling, CN	9
Shanghai, CN	8
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	6
Changsha, CN	6
Zhejiang Museum of Natural Historylocation not on record	4
Saint Louis, US	3
Hanshan Normal Universitylocation not on record	3
Fujian Institute of Subtropical Botanylocation not on record	3
Wuhan, CN	3
South China Normal Universitylocation not on record	3
Minia, EG	3
Herbarium of South China Botanical Gardenlocation not on record	2
Guiyang, CN	2
Peking Universitylocation not on record	2
Beijing Natural History Museumlocation not on record	2
Bronx, US	2
Wuhan, CN	2
Hangzhou Normal Collegelocation not on record	2
Nanjing, CN	2
Honolulu, US	2
Zhuzhou, CN	1
Institute of Applied Ecology, Academia Sinicalocation not on record	1
Lanzhou, CN	1
Nanjing, CN	1
Seoul, KR	1
Central China Normal Universitylocation not on record	1
Beijing, CN	1

46 institutions · 793 of 812 vouchered records shown · 18 without an institution code

09Environmental DNA21 detections

Where the DNA of Ilex asprella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 12.9–25.0

Seasonal swing summer↔winter24.8 °C

Max temp (day)28.5 °C 18.3–28.5

Min temp (night)19.2 °C 6.30–20.8

Precipitation213 mm/mo 53.6–228

Air humidity63.4 % 49.2–63.9

Moisture balance44.3 mm/mo -67.3–99.8

Vapour deficit1,116 Pa 885–1,145

Wind speed4.00 m/s 2.20–4.40

Cloud cover41.8 % 27.7–49.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ilex asprella

At a glance

Sources10 archives

Size & morphology5

Life cycle & reproduction4

Habitat & environment3

Physiology & chemistry5

Compound class profile1 class

Documented compounds2 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type3 055 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions29 of 46 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 055 records