Ilex amelanchier

M.A.Curtis ex Chapm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Aquifoliales/Aquifoliaceae/Ilex

At a glance

Occurrence records136

Data sources10

Biological traits87

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Ilex amelanchier's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility136 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources87 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF136 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Ilex amelanchier, the swamp holly or sarvis holly, is a rare species of holly from the southeastern United States. It is a close relative of mountain holly (Ilex mucronata) which used to be placed in a monotypic genus Nemopanthus. Ilex amelanchier grows near water, for example on streambanks. The dull red drupes appear in October to November, and may persist until the following spring. Its native range is limited to the Atlantic coastal plain and gulf coastal plain, and extends as far south as Florida, as far west as Louisiana, and as far north as North Carolina.United States Department of Agriculture Plants Pro

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTUSDATRY

Size & morphology1

Plant height4.89 m

Life cycle & reproduction25

Bloom periodMid Spring

Coppice potentialNo

Deciduousnessdeciduous

Dispersal typeanimal

Flower colouryellow

Flower conspicuousNo

Fruit seed period beginSummer

Fruit seed period endFall

Growth rate USDASlow

Life formtree

Life spanperennial

Lifespan categoryLong

Propagated by bare rootYes

Propagated by bulbNo

Propagated by containerYes

Propagated by cormNo

Propagated by cuttingsNo

Propagated by seedYes

Propagated by sodNo

Propagated by sprigsNo

Propagated by tubersNo

Resprout abilityYes

Seed spread rateSlow

Seedling vigorMedium

Vegetative spread rateNone

Habitat & environment22

Active growth periodSpring

Adapted to coarse textured soilsYes

Adapted to fine textured soilsNo

Adapted to medium textured soilsYes

BloatNone

Climatetemperate

Climberself-supporting

Foliage colorGreen

Foliage porosity summerDense

Foliage porosity winterModerate

Foliage textureMedium

Fruit colourred

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree, Shrub

Growth form USDAMultiple Stem

Hedge toleranceMedium

Known allelopathNo

Leaf retentionNo

Low growing grassNo

Root depth min12 in

Shape and orientationErect

Small grainNo

Woodinesswoody

Physiology & chemistry18

Anaerobic toleranceLow

Caco3 toleranceLow

Cold stratification requiredNo

Drought toleranceMedium

Fertility requirementLow

Fire resistantNo

Fire toleranceMedium

Frost free days min200 days

Moisture useMedium

Nitrogen fixation levelNone

Photosynthetic pathwayC3

Precipitation max60 in

Precipitation min45 in

Salinity toleranceNone

Shade toleranceLow

Soil pH max6.5 pH

Soil pH min3.5 pH

Temperature min12 °F

Uses & economy14

Berry nut seed productNo

Christmas tree productNo

Commercial availabilityRoutinely Available

Fodder productNo

Lumber productNo

Naval store productNo

Nursery stock productNo

Palatable browse animalMedium

Palatable graze animalMedium

Palatable humanNo

Post productNo

Pulpwood productNo

ToxicitySlight

Veneer productNo

Other traits7

Fall conspicuousNo

Fruit seed abundanceMedium

Fruit seed conspicuousYes

Fruit seed persistenceYes

Height at 20yr4.88 m

Planting density max3 450 per acre

Planting density min1 746 per acre

03Chemical composition2 compounds

Compounds documented for Ilex amelanchier across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Kaempferol		present	LOTUS
Quercetin		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ilex amelanchier has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences4

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSAJ275340.1 ↗696 bp

ACGT

TTGTCGATGCCTGCAAAGTAGACCCGGTGAACTTGTTAAAACATGCCCGGGGGTTTGAGAAGGGGTGCGCGAGCCCCCCCGACACACTCC …

Ilex amelanchier chloroplast 5.8S rRNA gene, internal transcribed spacer 1 (ITS1) and internal transcribed spacer 2 (ITS2)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type136 records

Wild obs. + sensor26

Museum / vouchered110

Range

Area of Occupancy AOO336 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 18≤1 km 2≤10 km 1>10 km 1

22 georeferenced · 4 without coordinates

Open the mapobservation + sensor26

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy72% within 1 km

≤100 m 26≤1 km 8≤10 km 6>10 km 7

47 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence110

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Jackson, US	37
Jena Microbial Resource Collectionlocation not on record	22
US	9
Tall Timbers Research Stationlocation not on record	9
Miami, US	6
Valdosta State Universitylocation not on record	5
Bronx, US	3
Mississippi State, US	3
Philadelphia, US	2
Wuzhou, CN	2
GAlocation not on record	2
University of Southern Mississippilocation not on record	2
University of Stellenboschlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
AUAlocation not on record	1
DOI/NPS, Mississippi National River & Recreation Arealocation not on record	1
Claremont, US	1
Beijing, CN	1
Columbia, US	1
Chapel Hill, US	1

20 institutions · 110 of 110 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Ilex amelanchier was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)