Ilex ambigua

(Michx.) Elliott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Aquifoliales/Aquifoliaceae/Ilex

At a glance

Occurrence records532

Data sources10

Biological traits10

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Ilex ambigua's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility532 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF532 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 40

01Narrative

Ilex ambigua is a species of flowering plant in the holly family known by the common names Carolina holly and sand holly. It is native to the southeastern and south-central United States, along the coastal plain from North Carolina to Texas, inland as far as Oklahoma, Arkansas, and Tennessee.Sullivan, Janet. 1994. Ilex ambigua. In: Fire Effects Information System, [Online]. United States Department of Agriculture, Forest Service, Rocky Mountain Research Station, Fire Sciences Laboratory.Biota of North America Program 2014 county distribution map

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height6.1 m

Life cycle & reproduction4

Deciduousnessevergreen

Dispersal typeanimal

Life formtree

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Tree, Shrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition2 compounds

Compounds documented for Ilex ambigua across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Flavonols2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Isorhamnetin		present	LOTUS
Kaempferol		present	LOTUS

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ilex ambigua has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKY627114.1 ↗557 bp

ACGT

AGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGAATTATTATACTCCTGAATATGAAACCAAAGATACTGATA …

Ilex ambigua voucher FLAS:Majure 4986 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Ilex ambigua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records40–402n range40median40mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 402×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Jensen 1944

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type532 records

Wild obs. + sensor469

Museum / vouchered56

Other7

Range

Area of Occupancy AOO1 312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 285≤1 km 57≤10 km 9>10 km 41

392 georeferenced · 77 without coordinates

Open the mapobservation + sensor469

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 2≤1 km 2≤10 km 1>10 km 43

48 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence56

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Miami, US	45
Austin, US	5
EL PASO, US	3
Tempe, US	1
Valdosta State Universitylocation not on record	1
Wuzhou, CN	1

6 institutions · 56 of 56 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)