Idioglossa miraculosa

(Frey & Boll, 1878) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Epimarptidae/Idioglossa

At a glance

Occurrence records60

Data sources7

Biological traits0

DNA specimens6

eDNA detections4

Sources7 archives

Databases and archives Idioglossa miraculosa's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility60 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF60 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD6 specimens

01Narrative

Idioglossa miraculosa is a moth of the family Batrachedridae. It was described by Frey and Boll in 1878. It is found in North America, where it has been recorded from Florida, Illinois, North Carolina, Ohio, Tennessee and Texas.Idioglossa at funet.fi.mothphotographersgroup The wingspan is about 10 mm.Description of Idiostoma americella in Trans. Amer. Ent. Soc. 10 : 199 There are two or three generations per year. The larvae feed on Dichanthelium clandestinum. They skeletonize the leaves of their host plant.Bug Guide

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Idioglossa miraculosa has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

378Cmostly conserved

412Gmostly conserved

AACAATATATTTTATTTTTGGTATTTGAGCTGGAATAATTGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAACCCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sarcinodes flavicanssame order9.1%Sarcinodes repurgatussame order9.4%Thalassodes linguissitasame order9.7%Amephana anarrhinisame order9.9%Blenina albifasciasame order10.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type60 records

Wild obs. + sensor32

Museum / vouchered28

Range

Area of Occupancy AOO136 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 7≤1 km 6≤10 km 5>10 km 7

25 georeferenced · 7 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 17

17 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	17
Washington, US	8
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1

4 institutions · 28 of 28 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Idioglossa miraculosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 22.8–23.5

Seasonal swing summer↔winter25.2 °C

Max temp (day)28.6 °C 28.6–28.8

Min temp (night)18.8 °C 18.8–19.2

Precipitation100 mm/mo 86.4–100

Air humidity54.3 % 54.3–57.3

Moisture balance-49.6 mm/mo -68.3–-49.6

Vapour deficit1,267 Pa 1,241–1,267

Wind speed4.50 m/s 2.90–4.50

Cloud cover26.0 % 26.0–30.7

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)