Idia forbesii

French, 1894 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Idia

At a glance

Occurrence records634

Data sources6

Biological traits0

DNA specimens48

eDNA detections47

Sources6 archives

Databases and archives Idia forbesii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility634 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF634 records

Environmental DNA1 datasets · 2 countries47 detections

DNA & barcodingBOLD48 specimens

01Narrative

Idia forbesii, or Forbes' idia moth, is a litter moth of the family Erebidae. The species was first described by George Hazen French in 1894. It is found in North America from Wisconsin to Quebec, south to Florida and Texas. The wingspan is about 17 mm. There is one generation in the north and multiple generations in the south. Larvae feed on detritus, including dead leaves.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Idia forbesii has left across the world's sequence archives.

At a glance

DNA specimens48

BINs4

Marker genes1

eDNA detections47

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus44 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 45 variable positions, in barcode order

34Tmostly conserved

50Tmostly conserved

76Avariable

85Avariable

91Amostly conserved

92Cmostly conserved

133Tmostly conserved

142Tmostly conserved

178Tmostly conserved

220Tmostly conserved

232Tmostly conserved

238Cmostly conserved

268Avariable

284Cvariable

287Tmostly conserved

292Cmostly conserved

298Tvariable

301Avariable

307Avariable

355Tvariable

361Tmostly conserved

368Gmostly conserved

379Avariable

397Tvariable

400Cmostly conserved

412Tmostly conserved

415Avariable

460Cmostly conserved

463Tvariable

475Cmostly conserved

478Cmostly conserved

479Tmostly conserved

499Tmostly conserved

511Avariable

514Tmostly conserved

520Amostly conserved

539Tmostly conserved

547Amostly conserved

568Tmostly conserved

571Tmostly conserved

596Tmostly conserved

616Tvariable

628Gmostly conserved

631Amostly conserved

634Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes9

BINs4

Most divergent pair5.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Idia laurentiisame genus3.3%Idia scobialissame genus3.5%Idia immaculalissame genus3.6%Idia occidentalissame genus3.8%Idia terrebralissame genus3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type634 records

Wild obs. + sensor381

Museum / vouchered253

Range

Area of Occupancy AOO1 164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 221≤1 km 45≤10 km 8>10 km 24

298 georeferenced · 83 without coordinates

Open the mapobservation + sensor381

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 21≤10 km 61>10 km 12

94 georeferenced · 159 without coordinates

Open the institutions mapphysical evidence253

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	47
North Carolina State University Insect Museumlocation not on record	44
New Haven, US	41
Cambridge, US	25
St. Paul, US	20
East Lansing, US	17
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Cornell University Insect Collectionlocation not on record	4
UDlocation not on record	2
Colorado State Universitylocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

12 institutions · 213 of 253 vouchered records shown · 40 without an institution code

09Environmental DNA47 detections

Where the DNA of Idia forbesii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found47

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 47 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 19.4–25.0

Seasonal swing summer↔winter26.4 °C

Max temp (day)25.2 °C 24.7–30.0

Min temp (night)17.8 °C 14.4–20.2

Precipitation106 mm/mo 83.5–129

Air humidity58.4 % 58.1–61.6

Moisture balance-48.7 mm/mo -67.3–0.5

Vapour deficit1,051 Pa 882–1,277

Wind speed2.80 m/s 1.50–3.50

Cloud cover39.5 % 27.4–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)