Ibervillea sonorae

(S.Watson) Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Cucurbitales/Cucurbitaceae/Ibervillea

At a glance

Occurrence records669

Data sources11

Biological traits13

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Ibervillea sonorae's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility669 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Chemical compositionLOTUS · NPASS23 compounds

Occurrence & distributionGBIF669 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Ibervillea sonorae is a tuberous perennial plant in the Cucurbitaceae family known by the common names wereke, wareque, guarequi, and coyote melon. It is a highly variable species characterized by a large, succulent tuberous root, which in the dry sand of its native habitat resembles a gray, dust-covered boulder. Emerging from the root yearly are long, flexible liana-like shoots, which reach a length of three or more meters. This species is native to northwestern Mexico, being found in the states of Baja California, Baja California Sur, Sonora and Sinaloa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass32.4 mg

Seed mass max32.4 mg

Seed mass min32.4 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formclimbing caudex geophyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatedesert or dry shrubland

Climberobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: climber

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition23 compounds

Compounds documented for Ibervillea sonorae across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols7

Cucurbitane triterpenoids6

Flavones4

Monoacylglycerols2

Isoflavones2

Documented compounds23 total

Tissue Source Quantified only

Compound	Amount	Source
(3R,8S,9R,10R,13R,14S,16R,17R)-16-hydroxy-4,4,9,13,14-pentamethyl-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-17-[(E,2R,3S)-2,3,6-trihydroxy-6-methylhept-4-en-2-yl]-1,2,3,7,8,10,12,15,16,17-decahydrocyclopenta[a]phenanthren-11-one	present	LOTUS
(3R,8S,9R,10R,13R,14S,16R,17R)-17-[(2R)-2,6-dihydroxy-6-methyl-3-oxoheptan-2-yl]-3,16-dihydroxy-4,4,9,13,14-pentamethyl-1,2,3,7,8,10,12,15,16,17-decahydrocyclopenta[a]phenanthren-11-one	present	LOTUS
(3R,8S,9R,10R,13R,14S,16R,17R)-17-acetyl-3,16-dihydroxy-4,4,9,13,14-pentamethyl-1,2,3,7,8,10,12,15,16,17-decahydrocyclopenta[a]phenanthren-11-one	present	LOTUS
(3R,8S,9R,10R,13R,14S,16R,17R)-3,16-dihydroxy-4,4,9,13,14-pentamethyl-17-[(E,2R,3S)-2,3,6-trihydroxy-6-methylhept-4-en-2-yl]-1,2,3,7,8,10,12,15,16,17-decahydrocyclopenta[a]phenanthren-11-one	present	LOTUS
(3R,8S,9R,10R,13R,14S,16R,17R)-3-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-16-hydroxy-4,4,9,13,14-pentamethyl-17-[(E,2R,3S)-2,3,6-trihydroxy-6-methylhept-4-en-2-yl]-1,2,3,7,8,10,12,15,16,17-decahydrocyclopenta[a]phenanthren-11-one	present	LOTUS
(3R,8S,9R,10R,13R,14S,16R,17R)-3-[(2R,3R,4S,5S,6R)-4,5-dihydroxy-6-(hydroxymethyl)-3-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxy-17-[(2R)-2,6-dihydroxy-6-methyl-3-oxoheptan-2-yl]-16-hydroxy-4,4,9,13,14-pentamethyl-1,2,3,7,8,10,12,15,16,17-decahydrocyclopenta[a]phenanthren-11-one	present	LOTUS
2-(3,4-dihydroxyphenyl)-5-hydroxy-6,7-dimethoxy-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	NPASS
6-Methylscutellarein	present	NPASS
Artemetin	present	NPASS
Casticin	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ibervillea sonorae has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences4

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSKJ531873.1 ↗690 bp

ACGT

GATCATTGTCGATGCCTAAACATCAAACGACCCGCGAACGTGTTTTAACAAACATCGTGCACGTGTGTCGAGGGAAGGGAGGGAGGGAGG …

Ibervillea sonorae voucher A. Flores 4580 (MEXU) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type669 records

Wild obs. + sensor476

Museum / vouchered193

Range

Area of Occupancy AOO1 632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 221≤1 km 75≤10 km 27>10 km 19

342 georeferenced · 134 without coordinates

Open the mapobservation + sensor476

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 90≤1 km 1≤10 km 9>10 km 4

104 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence193

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	69
Austin, US	23
ASUlocation not on record	13
Riverside, US	13
Mexico City, MX	9
La Paz, MX	7
Saint Louis, US	7
Phoenix, US	6
EL PASO, US	4
Universidad Autónoma de Occidentelocation not on record	4
Durango, MX	3
Arizona State University Biocollectionslocation not on record	3
Ann Arbor, US	3
Culiacán, MX	3
Universidad de Autonoma de Baja Californialocation not on record	2
McWane Science Centerlocation not on record	2
University of Stellenboschlocation not on record	2
Calabar, NG	2
Ensenada, MX	1
Claremont, US	1
Austin, US	1
San Francisco, US	1
Cambridge, US	1
Montecillo, Texcoco, MX	1
Hermosillo, MX	1
Juriquilla, MX	1
Monastir, TN	1
Bronx, US	1
Santa Barbara, US	1

29 institutions · 186 of 193 vouchered records shown · 7 without an institution code

09Environmental DNA1 detections

Where the DNA of Ibervillea sonorae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)