Iberodes linifolia

(L.) Serrano, R.Carbajal & S.Ortiz · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Boraginales/Boraginaceae/Iberodes

At a glance

Occurrence records341

Data sources11

Biological traits16

DNA specimens4

eDNA detections2

Sources11 archives

Databases and archives Iberodes linifolia's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility341 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF341 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Iberodes linifolia (syn. Omphalodes linifolia), also known as Venus's navelwort, white-flower navelwort and petite bourrache, is an annual species of flowering plant native Southwestern Europe, but has naturalized elsewhere in Europe, North Africa, North America and Chile. The plant is small, growing to 30 - tall by 15 cm wide, with blue-green foliage and tiny white or off-white flowers in Spring and Summer. It is distributed throughout dry open areas in full sun. The Latin specific epithet linifolia means “with leaves like flax (Linum)”. Under the name Omphalodes linifolia, this plant has gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass2.4 mg

Life cycle & reproduction5

Flowering endJun

Flowering startMay

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max200 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTroadsides

Woodinessnon-woody

03Chemical composition2 compounds

Compounds documented for Iberodes linifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Furofuranoid lignans2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Sesamin		present	LOTUS
Sesamolin		present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iberodes linifolia has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences9

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSDQ320756.1 ↗222 bpSpain

ACGT

ATCGCATCACCCCTTCACCAATTCGAAGAATGGGGTGGATTGTGACCTCCTGTAAATGTTGTGCAGTTGGTCCAAATTTGAGATCGGAGC …

Omphalodes linifolia internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Iberodes linifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2810×CCDB · iber-fl · CCDB · fl-europaea · CCDB · book-ipcn72 +4

CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. Fernandes, A. & M. T. Leitao.Bol. Soc. Brot. ser. 246: 389-404(1972).

CCDB · fl-europaea — Grau, 1967b

CCDB · book-ipcn72 — FERNANDES, A., & M.T. LEITAO. 1972. Contribution a la connansance cytotaxonomique des Spermatophyta du Portugal v. Boraginaceae Bol. soc. Brat. 46(Ser. 2): 389 405.

CCDB · book-ipcn67-71 — GRAU, J. 1967. Prirn~re und sekund~re Chrornosornenbasiszahlen bei Ornphalodes. Oesterr. Bot. Zeits. 114: 66-72.

CCDB · book-fedorov — Strey 1931

CCDB · book-fedorov — Britton 1951

CCDB · book-atlas-flowering-plants

CCDB · CromoCat 2015 — Britton, D. M. (1951). Cytogenetic studies on the Boraginaceae. Brittonia 7: 233-266.

CCDB · CromoCat 2015 — Fernandes, A. & Leitão, M. T. (1972). Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. V. Boraginaceae. Bol. Soc. Brot. 46: 389-405.

CCDB · CromoCat 2015 — Grau, J. (1967b). Primäre und sekundäre Chromosomenbasiszahlen bei Omphalodes. Österr. Bot. Z. 114: 66-72.

n 142×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Britton, D. M. (1951). Cytogenetic studies on the Boraginaceae. Brittonia 7: 233-266.

CCDB · CromoCat 2015 — Strey, M. (1931). Karyologische studien an Borraginoideae. Planta 14: 682-730.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type341 records

Wild obs. + sensor326

Museum / vouchered15

Origin

Native67

Range

Area of Occupancy AOO696 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 101≤1 km 86≤10 km 16>10 km 11

214 georeferenced · 112 without coordinates

Open the mapobservation + sensor326

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 2≤1 km 2≤10 km 5>10 km 1

10 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence15

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santiago de Compostela, ES	3
Bern, CH	2
SLU Artdatabankenlocation not on record	2
Turku, FI	1
Sion, CH	1
Entomological Society of Latvialocation not on record	1
Badajoz, ES	1
Porvoo, FI	1

8 institutions · 12 of 15 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Iberodes linifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 15.4–15.4

Seasonal swing summer↔winter15.3 °C

Max temp (day)20.5 °C

Min temp (night)10.4 °C

Precipitation70.4 mm/mo

Air humidity57.7 %

Moisture balance-28.0 mm/mo

Vapour deficit804 Pa

Wind speed2.90 m/s

Cloud cover41.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)