Iberis sempervirens
speciesAt a glance
Occurrence records6 091
Data sources10
Biological traits99
DNA specimens1
eDNA detections0
Sources10 archives
Databases and archives Iberis sempervirens's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility6 091 records↗
BOLD SystemsCentre for Biodiversity Genomics1 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources99 traits
Chemical compositionNPASS35 compounds
Occurrence & distributionGBIF6 091 records
DNA & barcodingBOLD · NCBI1 specimens
Genome at a glanceCCDB2n = 22
01Narrative
L'ibéris toujours vert est une espèce de plantes à fleurs de la famille des Brassicacées. C'est une plante vivace cultivée dans les jardins comme plante ornementale sous le nom de corbeille d'argent vivace. Autres noms vernaculaires : ibéris sempervirent, corbeille d'argent, thlaspi toujours vert, thlaspi de Candie.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRYUSDA
Size & morphology6
Plant height0.305 m
⚠ sources differ — USDA: 0.305 m · TRY: 0.102 m
Plant height max0.25 m
Plant height min0.1 m
Seed mass3.01 mg
⚠ sources differ — TRY: 3.01 mg · GIFT: 2.83 mg
Seed mass max2.83 mg
Seed mass min2.83 mg
Life cycle & reproduction28
Bloom periodEarly Summer
Coppice potentialNo
Deciduousnessevergreen
Flower colourwhite
Flower conspicuousYes
Flowering endAug
Flowering startMay
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formsubshrub
Life spanperennial
Lifespan categoryModerate
Lifespan years12 years
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formchamaephyte
Resprout abilityYes
Seed spread rateNone
Seedling vigorLow
Vegetative spread rateModerate
Diet & foraging1
Parasiteindependent
Habitat & environment24
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterDense
Foliage textureFine
Fruit colourbrown
Growth formshrub
⚠ sources differ — GIFT: shrub · TRY: Subshrub, Forb/herb
Growth form USDAStoloniferous
Hedge toleranceNone
Known allelopathNo
Leaf retentionYes
Low growing grassNo
Root depth min8 in
Shape and orientationProstrate
Small grainNo
Woodinesswoody
⚠ sources differ — TRY: woody · GIFT: variable
Physiology & chemistry21
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceNone
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantYes
Fire toleranceHigh
Frost free days min100 days
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max65 in
Precipitation min32 in
Protein potentialLow
Salinity toleranceNone
Shade toleranceMedium
Soil pH max7.3 pH
Soil pH min5.8 pH
Specific leaf area (SLA)11.54 mm²/mg
Temperature min-33 °F
Uses & economy13
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousYes
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max4 800 per acre
Planting density min2 700 per acre
03Chemical composition35 compounds
Compounds documented for Iberis sempervirens across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Simple coumarins12
Flavones6
Cinnamic acids and derivatives4
Stigmastane steroids2
Furofuranoid lignans2
Documented compounds35 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Syringaresinol | present | NPASS | |
| 2-Propenal, 3-(4-hydroxy-3-methoxyphenyl)- | present | NPASS | |
| 2-Propenoic acid, 3-(3,4-dihydroxyphenyl)-, ethyl ester | present | NPASS | |
| 3-(3,4-Dihydroxyphenyl)Prop-2-Enoic Acid | present | NPASS | |
| 3-(3-Hydroxy-4-methoxyphenyl)prop-2-enoic acid | present | NPASS | |
| 4-[(3S,3aS,6S,6aS)-6-(4-hydroxy-3,5-dimethoxy-phenyl)-1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan-3-yl]-2,6-dimethoxy-phenol | present | NPASS | |
| 4-Hydroxybenzoic acid | present | NPASS | |
| 4-Methylbenzaldehyde | present | NPASS | |
| 5,8-Dihydroxy-7,4'-dimethoxyflavone | present | NPASS | |
| 6,7-dimethoxy-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-2-one | present | NPASS |
05DNA & barcoding1 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iberis sempervirens has left across the world's sequence archives.
At a glance
DNA specimens1
Marker genes2
GenBank sequences10
Countries1
The DNA barcodea real sequence read deposited for this species
TCGATACCTGTCCAAAACAGAACGACCCGAGAACAATCGATCATCACCATCGGTAGACCGGTTTCTTAACCGATTCCGAGCCTATCGGTT …
Iberis sempervirens voucher HUB:Duman_4396 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★ITS9
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Iberis sempervirens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidypolyploid inferred
Chromosome records16–662n range22median22mode31records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2226×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 +6
CCDB · ipcn-api-dl — Franzen, R. & L. A. Gustavsson. 1983. Chromosome numbers in flowering plants from the high mountains of Sterea Ellas, Greece. Willdenowia 13: 101–106.
CCDB · ipcn-api-dl — Ančev, M. E. & V. Goranova. 1997. Mediterranean chromosome number reports 7 (855--872). Fl. Medit. 7: 246–258.
CCDB · ipcn-api-dl — Favarger, C. 1997. Notes de caryologie alpienne VI. Bull. Soc. Neuchateloise Sci. Nat. 120: 19–33.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Ancev, M. E. 1978b. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Nikolov, N. A. 1991. Chromosome numbers of Bulgarian angiosperms from North Pirin Mountain: Reserve "Bajuvi Dupki--D|3zind|3zirica". Fitologija 41: 70–75.
CCDB · book-ipcn75-78 — Ancev 1978
CCDB · book-ipcn73-74 — ENE, L.S.O. 1973. Polyploids in the genus Iberis. Cytologia 38: 699- 706.
CCDB · book-indian_vol1 — Jaretzky, R. 1932; Simonet, M. 1932c (Love, A. & Love, D. 1961b)
CCDB · eflora
CCDB · book-fedorov — Jaretzky 1932
CCDB · book-fedorov — Simonet 1932d
CCDB · book-fedorov — L. 1961)
CCDB · brass — Ancev
CCDB · brass — Nikolov
CCDB · brass — Ancev & Goranova
CCDB · brass — Favarger
CCDB · brass — Strid & Franzn
CCDB · brass — Franzn & Gustavsson
CCDB · brass — Franzn
CCDB · kew — Lysák MA, Koch MA, Beaulieu JM, Meister A, Leitch IJ. 2009. The dynamic ups and downs of genome size evolution in Brassicaceae. Molecular Biology and Evolution 26: 85-98.
CCDB · CromoCat 2015 — Ancev, M. E. (1978a). Karyological study of Bulgarian Campanulaceae. Fitologija 5: 66-74.
CCDB · CromoCat 2015 — Ancev, M. E. (1978c). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXII]. Taxon 27(5/6): 532-533.
CCDB · CromoCat 2015 — Nikolov, N.A. (1991). Chromosome numbers of Bulgarian Angiosperms from North Pirin mountain Fitologija 41: 70-75.
CCDB · CromoCat 2015 — Ancev, M. E. & Goranova, V. (1997). Mediterranean chromosome number reports-7. Fl. Medit. 7: 246-258.
CCDB · CromoCat 2015 — Strid, A. & R. Franzén. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXIII]. Taxon 30(4): 829-842.
2n 663×CCDB · ipcn-api-dl · CCDB · brass · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Galland, N. 1984. Chromosome Number Reports LXXXV. Taxon 33: 756–760.
CCDB · brass — Galland
CCDB · CromoCat 2015 — Galland, N. (1984). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXXV]. Taxon 33(4): 756-757.
2n 162×CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-indian_vol1 — Quezel, P. 1957
CCDB · book-fedorov — Quezel 1957
n 115×CCDB · ipcn-api-dl · CCDB · brass · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Montmollin, B. d. 1986. étude cytotaxonomique de la flore de la Crète. III. Nombres chromosomiques. Candollea 41: 431–439.
CCDB · brass — Montmollin
CCDB · brass — Jaretzky
CCDB · brass — Ene
CCDB · CromoCat 2015 — Montmollin, B. de. (1986). Étude cytotaxonomique de la flore de la Crète. III. Nombres chromosomiques. Candollea 41: 431-439.
n 331×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
n 351×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.932 ↗
08Occurrence & distribution
Record type6 091 records
Wild obs. + sensor5 505
Museum / vouchered526
Cultivated / captive7
Other53
Origin
Native1
Introduced208
Range
Area of Occupancy AOO11 836 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy55% within 1 km
≤100 m 1 767≤1 km 601≤10 km 1 849>10 km 110
4 327 georeferenced · 1 178 without coordinates
Open the mapobservation + sensor5 505
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy64% within 1 km
≤100 m 60≤1 km 67≤10 km 66>10 km 6
199 georeferenced · 327 without coordinates
Open the institutions mapphysical evidence526
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy67% within 1 km
≤100 m 1≤1 km 1≤10 km 1
3 georeferenced · 4 without coordinates
Open the mapnot free-living7
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions52 of 95 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 84 |
| BIO-UNIPIlocation not on record | 47 |
| Barcelona, ES | 43 |
| BDBClocation not on record | 31 |
| MAlocation not on record | 20 |
| BClocation not on record | 19 |
| SLU Artdatabankenlocation not on record | 15 |
| Bronx, US | 12 |
| KMNlocation not on record | 10 |
| Oskarshamn, SE | 9 |
| BRNUlocation not on record | 8 |
| València, ES | 8 |
| Berlin, DE | 7 |
| Wlocation not on record | 7 |
| GJOlocation not on record | 7 |
| Sant Julià de Lòria, AD | 7 |
| Provincia di Livornolocation not on record | 6 |
| Tilburg, NL | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| Frankfurt am Main | 5 |
| Salzburg, AT | 5 |
| Olocation not on record | 5 |
| University of Stellenboschlocation not on record | 5 |
| San Sebastián, ES | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Bern, CH | 5 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| DBF-NHMDlocation not on record | 4 |
| Paris, FR | 4 |
| GZUlocation not on record | 3 |
| Salamanca, ES | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| Vitoria, ES | 3 |
| BGBMlocation not on record | 3 |
| Alicante, ES | 3 |
| BFLlocation not on record | 3 |
| Badajoz, ES | 3 |
| Denver, US | 3 |
| Madrid, ES | 2 |
| Mohonk Preservelocation not on record | 2 |
| Porrentruy, CH | 2 |
| Saint Louis, US | 2 |
| Görlitz, DE | 2 |
| Vancouver, CA | 2 |
| Columbia, US | 2 |
| Chongqing Museumlocation not on record | 2 |
| Moscow State Universitylocation not on record | 2 |
| Logan, US | 1 |
| PUC-RSlocation not on record | 1 |
| Philadelphia, US | 1 |
| Tampa, US | 1 |
| Dekalb, US | 1 |
| Chapel Hill, US | 1 |
| WTUlocation not on record | 1 |
| Kunming, CN | 1 |
| Montréal, CA | 1 |
| Portland, US | 1 |
| Stockholm, SE | 1 |
| Bloomington, US | 1 |
| UniKSlocation not on record | 1 |
| Banyoles, ES | 1 |
| Long Beach, US | 1 |
| MeiseBGlocation not on record | 1 |
| Missoula, US | 1 |
| Karlsruhe, DE | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| RABATlocation not on record | 1 |
| Pamplona, ES | 1 |
| Washington, US | 1 |
| Helsinki, FI | 1 |
| Odawara, JP | 1 |
| Bangkok, TH | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Porvoo, FI | 1 |
| BSBIlocation not on record | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| Mlocation not on record | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| Bourges, FR | 1 |
| Turlock, US | 1 |
| Coimbra, PT | 1 |
| CICYTEXlocation not on record | 1 |
| Millersville, US | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| Ann Arbor, US | 1 |
| Tartu, EE | 1 |
| Riverside, US | 1 |
| Zürich, CH | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| CJBGlocation not on record | 1 |
95 institutions · 493 of 526 vouchered records shown · 33 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.