Iberis amara
speciesAt a glance
Occurrence records12 208
Data sources14
Biological traits48
DNA specimens20
eDNA detections11
Sources14 archives
Databases and archives Iberis amara's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility12 208 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics20 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources48 traits
Chemical compositionLOTUS · NPASS28 compounds
Occurrence & distributionGBIF12 208 records
Environmental DNA1 datasets · 4 countries11 detections
DNA & barcodingBOLD · NCBI20 specimens
Genome at a glanceCCDB · GoaT · NCBI998 Mbp
01Narrative
Iberis amara, de nom commun ibéris amer, est une espèce de plante sauvage du genre Iberis et de la famille de Brassicaceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology19
Fruit length5.5 mm
⚠ sources differ — AusTraits: 5.5 mm · GIFT: 4.5 mm
Fruit length max5 mm
Fruit length min4 mm
Fruit width4.5 mm
Fruit width max5 mm
Fruit width min4 mm
Leaf length50 mm
⚠ sources differ — AusTraits: 50 mm · GIFT: 20 mm
Leaf length max25 mm
Leaf length min15 mm
Plant height0.199 m
⚠ sources differ — GIFT: 0.199 m · AusTraits: 0.35 m · LEDA: 0.14 m · TRY: 0.22 m
Plant height generative0.2 m
Plant height max0.4 m
Plant height min0.07 m
Seed length2.25 mm
⚠ sources differ — TRY: 2.25 mm · GIFT: 3 mm
Seed length max3 mm
Seed length min3 mm
Seed mass2.35 mg
⚠ sources differ — TRY: 2.35 mg · LEDA: 1.88 mg · GIFT: 2.24 mg
Seed mass max4 mg
Seed mass min1.88 mg
Life cycle & reproduction13
Deciduousnessdeciduous
Dehiscencedehiscent
Dispersal typehuman
⚠ sources differ — LEDA: ethelochor · GIFT: anemochorous
Flowering endAug
Flowering startJun
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation mean2 600 m
Epiphyteterrestrial
Fruit typesilique
⚠ sources differ — AusTraits: silique · GIFT: capsule
Growth formherb
Habitat GIFTLowland
Leaf shapelinear oblanceolate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC3
Other traits2
Diaspore typeseed
Plant support typefree-standing
03Chemical composition28 compounds
Compounds documented for Iberis amara across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols13
Cucurbitane triterpenoids7
Cinnamic acids and derivatives2
Glucosinolates2
Simple coumarins1
Documented compounds28 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 2-(2,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | NPASS | |
| 3-(Methylsulfinyl)propyl glucosinolate | present | NPASS | |
| 3-(Methylthio)propylamine | present | LOTUS | |
| 3-[(S)-methylsulfinyl]propan-1-amine | present | LOTUS | |
| [(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl] (1Z)-4-[(S)-methylsulfinyl]-N-sulfooxybutanimidothioate | present | LOTUS | |
| [(E,6S)-6-[(8S,9R,10R,13R,14S,16R,17R)-2,16-dihydroxy-4,4,9,13,14-pentamethyl-3,11-dioxo-8,10,12,15,16,17-hexahydro-7H-cyclopenta[a]phenanthren-17-yl]-6-hydroxy-2-methyl-5-oxohept-3-en-2-yl] acetate | present | LOTUS | |
| Astragalin | present | NPASS | |
| CKIJIGYDFNXSET-NQLAUOAESA-N | present | NPASS | |
| Colocynthin | present | LOTUS | |
| coumarin | present | NPASS |
05DNA & barcoding20 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Iberis amara has left across the world's sequence archives.
At a glance
DNA specimens20
Marker genes6
GenBank sequences10
eDNA detections11
Countries4
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGTGTCACTAATC …
Iberis amara voucher CCDB-23367-D03 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL6★rbcLa★ITS2★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Iberis amara carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size997 560 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Iberis amara1.00 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidydiploid inferred
Chromosome records14–282n range14median14mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1429×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · iber-fl +9
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Nmeros cromosmicos de plantas espaolas. IV. Fernndez Casas, J.Anales Inst. Bot. Cavanilles34(1): 335-349(1977).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 394-403. Moreno, M.Lagascalia13(2): 307-311(1985).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 73-75. Ramos, A.Lagascalia8(1): 121-122(1978).
CCDB · iber-fl — Taxonoma de las especies endmicas del gnero Iberis L. (Cruciferae) en la pennsula Ibrica. Madrid. Moreno Sanz, M.*(1984).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2356
CCDB · ipcn-api-dl — Moreno, M. 1985. Números 394-403, In Números cromosómicos para la flora española. 363-434. Lagascalia 13: 307–311.
CCDB · ipcn-api-dl — Ramos, A. 1978. In Numeros cromosomicos para la flora Espanola. 45-83. Lagascalia 8: 105– 125.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · book-ipcn67-71 — ENE, L.S. o. 1971. A cytogenetic study of interspecific and allopolyploid hybrids of Iberis amara L. and l pectinata Boiss. (Cruciferae). Cytologia 36: 93-103.
CCDB · book-ipcn73-74 — KOUL, A.K., & R.N. GOHIL. 1973. Cytotaxonomical conspectus of the flora of Kashmir (1) Chromosome numbers of some common plants. Phyton (Horn) 15: 57-66.
CCDB · book-indian_vol1 — Manton, I. 1932; Resende, F. 1937; Bali, P.N. & Tandon, S.L. 1957; Tan- don, S.L. & Bali, P.N. 1957a, b; Ene, L.S.O. 1971
CCDB · eflora
CCDB · book-fedorov — Resende 1937a
CCDB · book-fedorov — Bali, Tandon 1957
CCDB · book-fedorov — Tandon, Bali 1957
CCDB · brass — Datta
CCDB · brass — Resende
CCDB · brass — Rollins
CCDB · brass — Ene
CCDB · brass — Manton
CCDB · brass — Fernndez Casas
CCDB · brass — Ramos
CCDB · brass — Moreno
CCDB · brass — Dempsey et al.
CCDB · CromoCat 2015 — Dempsey, R. E., Gornall, R. J. & Bailey, J. P. (1994). Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63-66.
2n 163×CCDB · book-ipcn73-74 · CCDB · book-indian_vol1 · CCDB · book-fedorov
CCDB · book-ipcn73-74 — ENE, L.S.O. 1973. Polyploids in the genus Iberis. Cytologia 38: 699- 706.
CCDB · book-indian_vol1 — Jaretzky, R. 1928c
CCDB · book-fedorov — Jaretzky 1928c
2n 281×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Tandon, S.L. & Bali, P.N. 1958b
n 716×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · brass
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 344-355. Ruz de Clavijo Jimnez, E. & F. Infante Garca-Pantalen.Anales Jard. Bot. Madrid42(2): 491-496(1986).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 691-719. Diosdado, J. C. & al.Lagascalia17(1): 173-184(1993).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 73-75. Ramos, A.Lagascalia8(1): 121-122(1978).
CCDB · ipcn-api-dl — Ruíz de Clavijo, E. & F. I. García-Panta-León. 1986. Números cromosomáticos de plantas occidentales, 344--355. Anales Jard. Bot. Madrid 42: 495–496.
CCDB · ipcn-api-dl — Diosdado, J. C., C. Santa-Bárbara, J. Vioque, R. Juan & J. Pastor. 1993. Números cromosomáticos para la flora Española. 691--719. Lagascalia 17: 173–184.
CCDB · ipcn-api-dl — Ramos, A. 1978. In Numeros cromosomicos para la flora Espanola. 45-83. Lagascalia 8: 105– 125.
CCDB · brass — Datta
CCDB · brass — Ene
CCDB · brass — Bali & Tandon
CCDB · brass — Tandon & Bali
CCDB · brass — Ramos
CCDB · brass — Ruz de Clavijo & Infante Garca-Pantalen
CCDB · brass — Diosdado et al.
n 144×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · brass +1
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn75-78 — Sharma 1970
CCDB · brass — Sharma
CCDB · CromoCat 2015 — Sharma, A. K. (1970). Annual report, 1967-1968 Res. Bull. Univ. Calcutta (Cytogenetics Lab.) 2: 1-50
n 81×CCDB · brass
CCDB · brass — Jaretzky
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
Completeness75.8% BUSCO
08Occurrence & distribution
Record type12 208 records
Wild obs. + sensor10 797
Museum / vouchered1 379
Cultivated / captive1
Other31
Origin
Native439
Introduced247
Range
Area of Occupancy AOO19 976 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy20% within 1 km
≤100 m 1 157≤1 km 491≤10 km 6 578>10 km 205
8 431 georeferenced · 2 366 without coordinates
Open the mapobservation + sensor10 797
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 63≤1 km 391≤10 km 398>10 km 32
884 georeferenced · 495 without coordinates
Open the institutions mapphysical evidence1 379
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 1
1 georeferenced
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions59 of 112 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Zürich, CH | 250 |
| Zürich, CH | 152 |
| MeiseBGlocation not on record | 115 |
| CJBGlocation not on record | 72 |
| BFLlocation not on record | 56 |
| Barcelona, ES | 54 |
| LDlocation not on record | 50 |
| Bern, CH | 44 |
| BDBClocation not on record | 39 |
| València, ES | 38 |
| BClocation not on record | 25 |
| MAlocation not on record | 22 |
| South Kensington, GB | 20 |
| SLU Artdatabankenlocation not on record | 20 |
| Adam Mickiewicz University in Poznańlocation not on record | 19 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 15 |
| Helsinki, FI | 14 |
| Olocation not on record | 14 |
| San Sebastián, ES | 13 |
| Oskarshamn, SE | 13 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 12 |
| Bourges, FR | 11 |
| Porrentruy, CH | 10 |
| QAUlocation not on record | 10 |
| Christchurch, NZ | 8 |
| KMNlocation not on record | 7 |
| GZUlocation not on record | 6 |
| Baroda, IN | 6 |
| Mlocation not on record | 6 |
| Moscow State Universitylocation not on record | 6 |
| Oulu, FI | 6 |
| Frauenfeld, CH | 5 |
| Istituto Agrario Castelnuovolocation not on record | 5 |
| Bronx, US | 5 |
| Salvador, BR | 4 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 4 |
| Nijmegen, NL | 4 |
| DAOlocation not on record | 4 |
| Trondheim, NO | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| UGentlocation not on record | 3 |
| Salzburg, AT | 3 |
| Uppsala, SE | 3 |
| Sant Julià de Lòria, AD | 3 |
| Regensburgische Botanische Gesellschaftlocation not on record | 3 |
| Chicago, US | 3 |
| Bergen, NO | 3 |
| Salamanca, ES | 3 |
| Paris, FR | 2 |
| DBF-NHMDlocation not on record | 2 |
| Wellington, NZ | 2 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 2 |
| TROMlocation not on record | 2 |
| Winterthur, CH | 2 |
| Provincia di Livornolocation not on record | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Berlin, DE | 2 |
| National Museum Waleslocation not on record | 2 |
| Glarus, CH | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Madrid, ES | 2 |
| Philadelphia, US | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Rotorua, NZ | 2 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| Ann Arbor, US | 1 |
| Ivano-Frankivsk, UA | 1 |
| Wlocation not on record | 1 |
| Pamplona, ES | 1 |
| NMWlocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Saint Louis, US | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Sevilla, ES | 1 |
| Podgorica, ME | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Portland, US | 1 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 1 |
| H-Drencklocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| Sion, CH | 1 |
| H-Zuccalocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Görlitz, DE | 1 |
| Riobamba, EC | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Mexico City, MX | 1 |
| Zacatecas, MX | 1 |
| Madison, US | 1 |
| Santa Barbara, US | 1 |
| Montecillo, Texcoco, MX | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| University of New Hampshirelocation not on record | 1 |
| Castelar, AR | 1 |
| ISAlocation not on record | 1 |
| Vitoria, ES | 1 |
| Pamplona, ES | 1 |
| Saint John, CA | 1 |
| Tallinn, EE | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Valparaiso, CL | 1 |
| Vancouver, CA | 1 |
| Canberra, AU | 1 |
| Smithfield, AU | 1 |
| TUR-Alocation not on record | 1 |
| Kuopio, FI | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Edinburgh, GB | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
112 institutions · 1 277 of 1 379 vouchered records shown · 99 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA11 detections
Where the DNA of Iberis amara was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map4 countries0
Chalk grasslandnear a station as a weedroadside
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.2 °C 9.80–17.7
Seasonal swing summer↔winter12.6 °C
Max temp (day)16.6 °C 13.3–21.8
Min temp (night)8.50 °C 5.40–13.9
Precipitation63.4 mm/mo 56.8–116
Air humidity62.3 % 60.2–65.2
Moisture balance-33.7 mm/mo -55.6–23.2
Vapour deficit529 Pa 460–809
Wind speed3.70 m/s 1.80–4.80
Cloud cover41.9 % 35.1–55.2
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.