Hypsophila halleyana

F.Muell. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Hypsophila

At a glance

Occurrence records172

Data sources5

Biological traits20

DNA specimens2

eDNA detections2

Sources5 archives

Databases and archives Hypsophila halleyana's data was compiled from.

GBIFGlobal Biodiversity Information Facility172 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF172 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology8

Fruit length50 mm

Fruit width17.5 mm

Leaf length90 mm

Leaf width22.5 mm

Petiole length0.4 cm

Plant height6 m

Seed length8 mm

Seed width5.5 mm

Life cycle & reproduction4

Flowering timennyyyyyyyyyy

Life formtree

Life spanperennial

Sex typehermaphrodite

Habitat & environment7

Climatewet tropical

Fruit fleshinessdry

Fruit typecapsule

Growth formshrub tree

Leaf compoundnesssimple

Leaf shapeelliptical oblong

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hypsophila halleyana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSEU328705.1 ↗623 bp

ACGT

AAAATGCCAGAACGACCCGTGAATCGATGGCAGCTGAAGTGGGGGGCTGGCCCTTCGGGCCTGTCGTCCGAAGTTCCCGGCGAGGGCTGT …

Hypsophila halleyana 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type172 records

Wild obs. + sensor6

Museum / vouchered161

Cultivated / captive1

Other4

Origin

Native2

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 3 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 38≤1 km 17≤10 km 54>10 km 2

111 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence161

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	60
Brisbane, AU	32
Museo Entomologico de Leonlocation not on record	19
Canberra, AU	13
James Cook Townsvillelocation not on record	3
Kew, GB	3
Hobart, AU	2
Mount Annan, AU	2
Armidale, AU	2
Palmerston, AU	2
Claremont, US	1
Zürich, CH	1
Adelaide, AU	1

13 institutions · 141 of 161 vouchered records shown · 20 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Hypsophila halleyana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)