Hypsophila dielsiana

Loes. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Hypsophila

At a glance

Occurrence records300

Data sources5

Biological traits22

DNA specimens3

eDNA detections3

Sources5 archives

Databases and archives Hypsophila dielsiana's data was compiled from.

GBIFGlobal Biodiversity Information Facility300 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF300 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology9

Fruit length100 mm

Fruit width22.5 mm

Leaf length170 mm

Leaf mass per area97.09 g/m2

Leaf width50 mm

Petiole length0.55 cm

Plant height10 m

Seed length10 mm

Seed width5.5 mm

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timenyyyyyyyyyyn

Life formtree

Life spanperennial

Sex typehermaphrodite

Habitat & environment7

Climatewet tropical

Fruit fleshinessdry

Fruit typecapsule

Growth formtree

Leaf compoundnesssimple

Leaf shapeelliptical lanceolate oblanceolate oblong

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hypsophila dielsiana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU328704.1 ↗701 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAAAATGCTAGAACGACCCGTGAATCGATGGCAGCTGAAGTGGGGGGCTGGCCCT …

Hypsophila dielsiana 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type300 records

Wild obs. + sensor31

Museum / vouchered238

Other31

Origin

Native4

Range

Area of Occupancy AOO472 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 8≤1 km 8≤10 km 1

17 georeferenced · 14 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 37≤1 km 36≤10 km 74>10 km 7

154 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence238

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	114
Brisbane, AU	67
Canberra, AU	18
Zürich, CH	8
Museo Entomologico de Leonlocation not on record	6
Mount Annan, AU	4
Kew, GB	4
James Cook Townsvillelocation not on record	3
Palmerston, AU	2
Parkville, AU	1
Adelaide, AU	1
Armidale, AU	1

12 institutions · 229 of 238 vouchered records shown · 8 without an institution code

09Environmental DNA3 detections

Where the DNA of Hypsophila dielsiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)