Hypserpa smilacifolia

Diels · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Menispermaceae/Hypserpa

At a glance

Occurrence records103

Data sources5

Biological traits19

DNA specimens1

eDNA detections1

Sources5 archives

Databases and archives Hypserpa smilacifolia's data was compiled from.

GBIFGlobal Biodiversity Information Facility103 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF103 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPAusTraitsTRY

Size & morphology7

Fruit length10.5 mm

Fruit width11 mm

Leaf length105 mm

Leaf width60 mm

Petiole length4.4 cm

Seed length7.5 mm

Seed width5.5 mm

Life cycle & reproduction5

Deciduousnessevergreen

Flowering timennnnnnnyyynn

Life formclimber

Life spanperennial

Sex typedioecious

Habitat & environment7

Climatewet tropical

Fruit fleshinessfleshy

Fruit typedrupe

Growth formclimber

Leaf compoundnesssimple

Leaf shapeelliptical oblong ovate peltate

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hypserpa smilacifolia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496310.1 ↗566 bpAustralia · 2013

ACGT

CTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATACGC …

Hypserpa smilacifolia isolate D11 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

08Occurrence & distribution

Record type103 records

Wild obs. + sensor5

Museum / vouchered90

Other8

Origin

Native1

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 23≤1 km 12≤10 km 25

60 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence90

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Smithfield, AU	44
Brisbane, AU	27
Kew, GB	5
Canberra, AU	3
Museo Entomologico de Leonlocation not on record	2
CSIROlocation not on record	1
Mount Annan, AU	1
AUAlocation not on record	1
Saint Louis, US	1
Adelaide, AU	1
Honolulu, US	1
Palmerston, AU	1

12 institutions · 88 of 90 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Hypserpa smilacifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.9 °C 21.9–21.9

Seasonal swing summer↔winter18.4 °C

Max temp (day)28.5 °C

Min temp (night)15.0 °C

Precipitation15.6 mm/mo

Air humidity43.4 %

Moisture balance-143 mm/mo

Vapour deficit1,624 Pa

Wind speed4.00 m/s

Cloud cover18.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)