Hyponephele lupinus

Costa, 1836 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Hyponephele

At a glance

Occurrence records2 030

Data sources6

Biological traits0

DNA specimens9

eDNA detections82

Sources6 archives

Databases and archives Hyponephele lupinus's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 030 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI82 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF2 030 records

Environmental DNA1 datasets · 12 countries82 detections

DNA & barcodingBOLD9 specimens

Genome at a glanceNCBI≈509 Mbp

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hyponephele lupinus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs3

Marker genes1

eDNA detections82

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 85 variable positions, in barcode order

22Amostly conserved

34Tmostly conserved

40Tmostly conserved

43Gvariable

46Amostly conserved

49Cvariable

56Cmostly conserved

58Tmostly conserved

67Amostly conserved

82Cvariable

85Tmostly conserved

88Avariable

92Cvariable

106Tvariable

118Tvariable

127Tvariable

133Tmostly conserved

142Tmostly conserved

163Tmostly conserved

166Amostly conserved

169Tmostly conserved

202Cvariable

205Cmostly conserved

206Cmostly conserved

208Tmostly conserved

232Tmostly conserved

247Tmostly conserved

265Tvariable

271Avariable

274Cvariable

281Avariable

283Tmostly conserved

307Amostly conserved

322Tmostly conserved

325Tmostly conserved

334Tvariable

337Amostly conserved

340Cvariable

347Tmostly conserved

349Amostly conserved

352Tmostly conserved

361Tmostly conserved

364Cmostly conserved

374Gmostly conserved

379Amostly conserved

382Tmostly conserved

385Tmostly conserved

391Tmostly conserved

406Cvariable

412Cvariable

418Tmostly conserved

421Amostly conserved

427Tmostly conserved

436Tmostly conserved

445Tmostly conserved

451Avariable

463Cvariable

470Gmostly conserved

482Tmostly conserved

487Tvariable

490Tvariable

499Tmostly conserved

514Amostly conserved

517Tmostly conserved

542Tmostly conserved

544Amostly conserved

547Tmostly conserved

550Amostly conserved

553Amostly conserved

556Tvariable

562Tmostly conserved

578Cmostly conserved

580Tmostly conserved

581Cmostly conserved

583Tmostly conserved

604Cmostly conserved

607Tmostly conserved

616Cmostly conserved

619Tvariable

622Avariable

637Amostly conserved

640Tvariable

646Tmostly conserved

652Tmostly conserved

658Tmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTTGGGACATCCCTTAGTCTTATTATTCGAACAGAATTAGGTAACCCTGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.2%

Haplotypes5

BINs3

Most divergent pair10.8%

AsiaEuropeAfrica

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hyponephele davendrasame genus3.2%Hyponephele kocakisame genus3.8%Hyponephele korshunovisame genus4.1%Hyponephele laetasame genus4.4%Hyponephele dysdorasame genus4.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceNCBI

The complete instruction manual Hyponephele lupinus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈508 647 412 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Hyponephele lupinus0.51 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type2 030 records

Wild obs. + sensor1 623

Museum / vouchered365

Cultivated / captive37

Other5

Origin

Native42

Range

Area of Occupancy AOO3 632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 362≤1 km 242≤10 km 387>10 km 37

1 028 georeferenced · 595 without coordinates

Open the mapobservation + sensor1 623

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 17≤1 km 70≤10 km 101>10 km 10

198 georeferenced · 167 without coordinates

Open the institutions mapphysical evidence365

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 37 records without

Open the mapnot free-living37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	124
Tartu, EE	66
Natural History Museum Rotterdamlocation not on record	55
Cambridge, US	19
Philadelphia, US	17
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	13
New Haven, US	8
Nijmegen, NL	6
MZLUlocation not on record	4
Salzburg, AT	2
Banyoles, ES	2
RBINS-Scientific Heritagelocation not on record	2
Brussels, BE	2
Zürich, CH	1

14 institutions · 321 of 365 vouchered records shown · 44 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA82 detections

Where the DNA of Hyponephele lupinus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found82

Studies independent surveys1

Countries12

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 82 detections have coordinates

Open the map12 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 13.8–23.9

Seasonal swing summer↔winter19.5 °C

Max temp (day)25.8 °C 18.3–30.1

Min temp (night)14.1 °C 7.80–18.0

Precipitation30.7 mm/mo 5.60–54.6

Air humidity51.0 % 44.9–58.3

Moisture balance-133 mm/mo -186–-19.5

Vapour deficit1,257 Pa 741–1,614

Wind speed3.10 m/s 2.30–4.40

Cloud cover28.5 % 14.7–39.7

CHELSA 1981–2010, ~9 km grid, at location & month of 69 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hyponephele lupinus

At a glance

Sources6 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 030 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 14 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 030 records