Hypolaena fastigiata

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Restionaceae/Hypolaena

At a glance

Occurrence records9 437

Data sources10

Biological traits45

DNA specimens2

eDNA detections1

Sources10 archives

Databases and archives Hypolaena fastigiata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 437 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources45 traits

Chemical compositionLOTUS · NPASS76 compounds

Occurrence & distributionGBIF9 437 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 66

01Narrative

Hypolaena fastigiata là một loài thực vật có hoa trong họ Restionaceae. Loài này được R.Br. mô tả khoa học đầu tiên năm 1810.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology17

Fruit length4 mm

Fruit width2 mm

Leaf length3 mm

Leaf length max1.3 mm

Leaf length min1 mm

Leaf mass per area476 g/m2

Leaf size383 mm²

Leaf width max1.3 mm

Leaf width min1 mm

Plant height0.3 m

Plant height max0.3 m

Plant height min0.15 m

Seed length2.8 mm

Seed mass5.46 mg

⚠ sources differ — TRY: 5.46 mg · AusTraits: 4.95 mg · GIFT: 5.46 mg

Seed mass max5.46 mg

Seed mass min5.46 mg

Seed width1.45 mm

Life cycle & reproduction12

Deciduousnessevergreen

Dehiscenceindehiscent

Dispersal typewind

Flowering timennnnnnnnyyyy

Life formrhizomatous geophyte

Life spanperennial

Lifespan years55 years

Pollination syndromewind

Raunkiær life formcryptophyte

Reproductive maturity2 years

Resprouting capacityresprouts

Sex typedioecious

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typenut

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: graminoid herb

Leaf compoundnesssimple

Leaf shapelinear

Woodinessnon-woody

Physiology & chemistry4

Leaf n5.5 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)2.1 mm²/mg

Other traits1

Plant support typefree-standing

03Chemical composition76 compounds

Compounds documented for Hypolaena fastigiata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Spirostane steroids15

Furostane steroids12

Friedelane triterpenoids2

Stigmastane steroids1

Flavones1

Documented compounds76 total

Tissue Source Quantified only

Compound	Amount	Source
(22r)-22-Hydroxycholes-terol	present	NPASS
(2R,3R,4S,5S,6R)-2-[(2R)-4-[(1R,2R,4S,6R,7S,8R,9S,12S,13R,14R,16R)-14-[(2R,3R,4S,5R,6R)-3-[(2S,3R,4R,5S,6S)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-16-hydroxy-6-methoxy-7,9,13-trimethyl-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-6-yl]-2-methylbutoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[[(2R,3S,4S,5R,6S)-3,4,5-trihydroxy-6-[(1S,2S,3'S,4S,5'R,6S,7S,8R,9S,12S,13R,16S)-16-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-3'-yl]oxyoxan-2-yl]methoxy]oxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-4,5-dihydroxy-2-[[(1R,2R,4S,6R,7S,8R,9S,12S,13R,14R,16R)-16-hydroxy-6-methoxy-7,9,13-trimethyl-6-[(3R)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-14-yl]oxy]-6-(hydroxymethyl)oxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3R,4S,5R,6R)-4,5-dihydroxy-6-(hydroxymethyl)-2-[(1R,2S,4S,5'R,6R,7S,8R,9S,12R,13R,14R,16R)-16-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-14-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S)-2-[[(1S,2S,4S,6R,7S,8R,9S,12S,13R,14R,16R)-6,16-dihydroxy-7,9,13-trimethyl-6-[(3R)-3-methyl-4-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-14-yl]oxy]-4,5-dihydroxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S)-2-[[(1S,2S,4S,6R,7S,8R,9S,12S,13R,14R,16R)-6,16-dihydroxy-7,9,13-trimethyl-6-[3-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]but-3-enyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-14-yl]oxy]-4,5-dihydroxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S)-4,5-dihydroxy-2-[(1S,2S,4S,5'R,6R,7S,8R,9S,12S,13R,14R,16R)-16-hydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-14-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S)-4,5-Dihydroxy-2-[(1S,2S,4S,6R,7S,8R,9S,12S,13R,14R,16R)-16-hydroxy-7,9,13-trimethyl-5'-methylidenespiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-14-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5S)-4,5-dihydroxy-2-[[(1S,2S,4S,6R,7S,8R,9S,12S,13R,14R,16R)-16-hydroxy-6-methoxy-7,9,13-trimethyl-6-[3-[[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]but-3-enyl]-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-14-yl]oxy]oxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hypolaena fastigiata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLON594256.1 ↗622 bpAustralia · 2016

ACGT

AACGACATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAAGATTATAAATTGACTTATTACACTCCTGAC …

Hypolaena fastigiata voucher 600200247 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1trnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Hypolaena fastigiata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 66 n = 33

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 661×CCDB · book-ipcn66

CCDB · book-ipcn66 — Briggs 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type9 437 records

Wild obs. + sensor8 183

Museum / vouchered1 237

Cultivated / captive1

Other16

Origin

Native1 588

Range

Area of Occupancy AOO13 740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 5 708≤1 km 1 541≤10 km 565>10 km 35

7 849 georeferenced · 334 without coordinates

Open the mapobservation + sensor8 183

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 137≤1 km 251≤10 km 422>10 km 84

894 georeferenced · 343 without coordinates

Open the institutions mapphysical evidence1 237

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 33 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adelaide, AU	325
Museo Entomologico de Leonlocation not on record	195
Mount Annan, AU	180
QVMAGlocation not on record	107
Hobart, AU	91
Canberra, AU	82
Kensington, AU	66
Brisbane, AU	43
Armidale, AU	20
John T. Waterhouse Herbariumlocation not on record	18
La Trobe Universitylocation not on record	8
Kew, GB	8
BGPAlocation not on record	7
Auckland, NZ	6
NSW Dept of Planning, Industry and Environmentlocation not on record	5
MAlocation not on record	4
South Kensington, GB	3
Wollongong, AU	3
Palmerston, AU	3
Smithfield, AU	3
Buenos Aires, AR	3
Vancouver, CA	2
MeiseBGlocation not on record	2
EL PASO, US	2
University of the Sunshine Coastlocation not on record	1
GB	1
Claremont, US	1
Parkville, AU	1
Zürich, CH	1
LDlocation not on record	1
US	1
Beijing, CN	1
Batemans Bay, AU	1

33 institutions · 1 195 of 1 237 vouchered records shown · 42 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Hypolaena fastigiata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 22.4–22.4

Seasonal swing summer↔winter8.90 °C

Max temp (day)25.4 °C

Min temp (night)19.6 °C

Precipitation134 mm/mo

Air humidity59.7 %

Moisture balance-27.6 mm/mo

Vapour deficit1,082 Pa

Wind speed2.60 m/s

Cloud cover21.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hypolaena fastigiata

At a glance

Sources10 archives

Size & morphology17

Life cycle & reproduction12

Diet & foraging1

Habitat & environment10

Physiology & chemistry4

Other traits1

Compound class profile5 classes

Documented compounds76 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type9 437 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 33 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 437 records