Hypoglossum hypoglossoides

(Stackhouse) F.S.Collins & Hervey · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Ceramiales/Delesseriaceae/Hypoglossum

At a glance

Occurrence records10 740

Data sources8

Biological traits2

DNA specimens36

eDNA detections29

Sources8 archives

Databases and archives Hypoglossum hypoglossoides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 423 records↗

OBISOcean Biodiversity Information System5 317 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS10 740 records

Environmental DNA2 datasets · 6 countries29 detections

DNA & barcodingBOLD · NCBI36 specimens

01Narrative

Hypoglossum hypoglossoides, known as under tongue weed, is a small red marine alga in the family Delesseriaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hypoglossum hypoglossoides has left across the world's sequence archives.

At a glance

DNA specimens36

BINs2

Marker genes5

GenBank sequences3

eDNA detections29

The DNA barcodea real sequence read deposited for this species

rbcLKR604846.1 ↗1 197 bpUnited Kingdom

ACGT

GTAGATGCTGTTCCTAATACAAGTGATCAATTTTTTGCATATATTTCTTATGATATTGATTTATTTGAAGAAGGTTCTATTGCAAACTTA …

Hypoglossum hypoglossoides voucher CUK11316 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dasya tenuissame family12.3%Osmundea osmundasame order13.0%Membranoptera fabricianasame family13.0%Delesseria sanguineasame family13.3%Callithamnion tetricumsame order13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL328S28S-D2UPA

animal barcodeplant barcodemarker

08Occurrence & distribution

Record type10 740 records

Wild obs. + sensor3 738

Museum / vouchered4 977

Other2 025

Origin

Native19

Range

Area of Occupancy AOO8 344 km²

Depth

0–200 m sunlit2 128

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 10 m · max 275 m · 2 129 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 3 233≤1 km 230≤10 km 175>10 km 1

3 639 georeferenced · 99 without coordinates

Open the mapobservation + sensor3 738

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 97≤1 km 39≤10 km 65>10 km 12

213 georeferenced · 4 764 without coordinates

Open the institutions mapphysical evidence4 977

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institut Francais pour l'Etude de la Merlocation not on record	602
486location not on record	377
DASSHlocation not on record	45
South Kensington, GB	42
Ann Arbor, US	34
PNHSlocation not on record	31
MeiseBGlocation not on record	31
UAclocation not on record	28
Durham, US	25
Museum national d'Histoire naturellelocation not on record	21
Tartu Fungal Culture Collectionlocation not on record	13
University of Stellenboschlocation not on record	10
Chapel Hill, US	7
Bronx, US	7
CEFASlocation not on record	6
Clocation not on record	6
Universidad de Oviedolocation not on record	5
LDlocation not on record	5
Barcelona, ES	4
València, ES	4
Bourges, FR	3
Instituto de Investigaciones Marinas y Costeras José Benito Vives de Andreis - Invemarlocation not on record	3
Naturalis Biodiversity Centerlocation not on record	2
IPA/SPlocation not on record	2
Mexico City, MX	2
Marine Biological Association of the UKlocation not on record	2
PHlocation not on record	2
JBRJlocation not on record	2
BISHlocation not on record	2
University of Messina, Phycological Lablocation not on record	2
Honolulu, US	2
Burlington, US	2
San Diego, US	2
BClocation not on record	1
Tilburg, NL	1
Minia, EG	1
McWane Science Centerlocation not on record	1
Auckland, NZ	1
Arcata, US	1
New Haven, US	1
Universidad de Málagalocation not on record	1
BDBClocation not on record	1

42 institutions · 1 340 of 4 977 vouchered records shown · 210 without an institution code

09Environmental DNA29 detections

Where the DNA of Hypoglossum hypoglossoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys2

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map6 countries0

rocky shore/estuary

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature19.6 °C 13.7–29.9

pH8.10 7.66–8.18

Conductivity47,716 µS/cm 38,000–48,384

Salinity35.7 PSU 23.9–36.9

Dissolved oxygen7.55 mg/L 4.50–9.45

Turbidity0.287 NTU 0.065–0.9

Nitrate0.4 µmol/L 0.1–0.7

Sand99.2 %

Depth2.00 m 0–47.0

Coastal waterSedimentPelagic

19 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 10.7–24.5

Seasonal swing summer↔winter9.30 °C

Max temp (day)20.6 °C 13.4–25.2

Min temp (night)14.1 °C 5.90–23.1

Precipitation75.7 mm/mo 25.7–105

Air humidity57.1 % 54.8–64.7

Vapour deficit889 Pa 493–1,208

Cloud cover25.2 % 8.90–50.6

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hypoglossum hypoglossoides

At a glance

Sources8 archives

Habitat & environment2

At a glance

Record type10 740 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 42 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type10 740 records