Hypoestes floribunda

R.Br. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Acanthaceae/Hypoestes

At a glance

Occurrence records1 090

Data sources7

Biological traits37

DNA specimens3

eDNA detections2

Sources7 archives

Databases and archives Hypoestes floribunda's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 090 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources37 traits

Occurrence & distributionGBIF1 090 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 30

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology12

Fruit length10.5 mm

Leaf length90 mm

Leaf length max90 mm

Leaf length min10 mm

Leaf width17.5 mm

Leaf width max25 mm

Leaf width min4 mm

Plant height1 m

Plant height max1.5 m

Plant height min0.25 m

Seed length1.5 mm

Seed width1 mm

Life cycle & reproduction11

Dehiscencedehiscent

Dispersal typeanimal

Flowering endAug

Flowering startMay

Flowering timennyyyyyyynnn

Life spanperennial

Pollination syndromeinsect

Raunkiær life formtherophyte

Reproductive maturity1 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeelliptical

Woodinessnon-woody+woody

⚠ sources differ — AusTraits: herbaceous woody · GIFT: non-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hypoestes floribunda has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences1

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKF496829.1 ↗552 bpAustralia · 2013

ACGT

AGTGTTGGATTCAAAGCGGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAAGATACTGATATCTTGGCAGCA …

Hypoestes floribunda isolate BATT824-10 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Hypoestes floribunda carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 151×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Daniel, T. F. 2000. Chromosome numbers of some Acanthaceae from Papua New Guinea. Austrobaileya 5(4): 651–659.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 090 records

Wild obs. + sensor674

Museum / vouchered341

Other75

Origin

Native31

Introduced1

Range

Area of Occupancy AOO3 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 204≤1 km 14≤10 km 4>10 km 5

227 georeferenced · 447 without coordinates

Open the mapobservation + sensor674

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 88≤1 km 50≤10 km 110>10 km 2

250 georeferenced · 91 without coordinates

Open the institutions mapphysical evidence341

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	72
Smithfield, AU	52
Museo Entomologico de Leonlocation not on record	33
Palmerston, AU	32
Adelaide, AU	31
Kensington, AU	26
Mount Annan, AU	18
Kew, GB	14
Canberra, AU	8
University of Stellenboschlocation not on record	6
Fort Worth, US	5
Honolulu, US	4
James Cook Townsvillelocation not on record	4
South Kensington, GB	3
John T. Waterhouse Herbariumlocation not on record	3
Armidale, AU	2
Australian Tropical Herbariumlocation not on record	1
Guangzhou, CN	1
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Hobart, AU	1
IPA/SPlocation not on record	1

21 institutions · 318 of 341 vouchered records shown · 22 without an institution code

09Environmental DNA2 detections

Where the DNA of Hypoestes floribunda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.3 °C 22.4–26.3

Seasonal swing summer↔winter12.7 °C

Max temp (day)30.1 °C 28.8–31.4

Min temp (night)18.2 °C 15.6–20.7

Precipitation27.2 mm/mo 17.9–36.6

Air humidity49.4 % 44.6–54.3

Moisture balance-130 mm/mo -140–-119

Vapour deficit1,593 Pa 1,568–1,618

Wind speed3.80 m/s 3.60–3.90

Cloud cover35.1 % 21.5–48.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hypoestes floribunda

At a glance

Sources7 archives

Size & morphology12

Life cycle & reproduction11

Diet & foraging1

Habitat & environment10

Physiology & chemistry2

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 090 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 090 records