Hypochaeris radicata
speciesAt a glance
Occurrence records820 928
Data sources14
Biological traits71
DNA specimens70
eDNA detections43
Sources14 archives
Databases and archives Hypochaeris radicata's data was compiled from.
WikipediaWikimedia Foundation14 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility820 928 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics70 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources71 traits
Occurrence & distributionGBIF820 928 records
Environmental DNA1 datasets · 9 countries43 detections
DNA & barcodingBOLD · NCBI70 specimens
Genome at a glanceCCDB · GoaT1.5 Gbp
01Narrative
Hypochaeris radicata yellow flowers Hypochaeris radicata (sometimes spelled Hypochoeris radicata) – also known as catsear, flatweed, cat's-ear, hairy cat's ear, or false dandelion – is a perennial, low-lying edible herb often found in lawns. The plant is native to Europe,Altervista Flora Italiana, Hypochaeris radicata L. includes photos and European distribution map but has also been introduced to the Americas,Biota of North America Program 2014 county distribution mapJørgensen, P. M., M. H. Nee & S. G. Beck. (eds.) 2014. Catálogo de las plantas vasculares de Bolivia, Monographs in systematic botany from the Missouri Botanical Garden 127(1–2): i–viii, 1–1744.Luteyn, J. L. 1999. Páramos, a checklist of plant diversity, geographical distribution, and botanical literature. Memoirs of The New York Botanical Garden 84: viii–xv, 1–278. Japan,Flora of China, Hypochaeris radicata Linnaeus, 1753. 假蒲公英猫儿菊 jia pu gong ying mao er ju Australia,Atlas of Living Australia, Hypochaeris radicata L., Cat's Ear and New Zealand, where it can be an invasive weed. It is listed as a noxious weed in the northwestern U.S. state of Washington.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology23
Fruit length12.5 mm
Fruit length max19 mm
Fruit length min14 mm
Leaf length50 mm
Leaf length max200 mm
Leaf length min50 mm
Leaf mass28.1 mg
Leaf mass per area51.11 g/m2
Leaf size847 mm²
⚠ sources differ — TRY: 847 mm² · AusTraits: 462 mm²
Leaf width14 mm
⚠ sources differ — AusTraits: 14 mm · GIFT: 24 mm
Leaf width max40 mm
Leaf width min10 mm
Plant height0.32 m
⚠ sources differ — GIFT: 0.32 m · AusTraits: 0.8 m · TRY: 0.1 m
Plant height generative0.345 m
Plant height max1.5 m
Plant height min0.08 m
Seed length6 mm
Seed mass0.818 mg
⚠ sources differ — TRY: 0.818 mg · AusTraits: 0.621 mg · GIFT: 0.814 mg
Seed mass max1.1 mg
Seed mass min0.66 mg
Seed volume1.8 mm³
Seed volume max1.8 mm³
Seed volume min1.8 mm³
Life cycle & reproduction18
DeciduousnessDeciduous
⚠ sources differ — TRY: Deciduous · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typewind
Flower colouryellow
Flowering endSep
Flowering startJun
Flowering timennnnnnnnyynn
Life formperennial
Life spanperennial
Lifespan years2.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Reproductive maturity1 years
Resprouting capacityresprouts
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 500 m
Elevation mean2 250 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourbrown
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTCampo Limpo, Floresta Ombrófila (= Floresta Pluvial)
Leaf compoundnesssimple
Leaf shapeoblanceolate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry8
Leaf C:N ratio18.08 g/g
Leaf c417 mg/g
Leaf dry-matter content (LDMC)125 mg/g
Leaf n16.07 mg/g
Leaf p2.7 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)22.35 mm²/mg
Other traits4
Diaspore typeone-seeded generative dispersule
Leaf arrangementrosette
Seeds per fruit101-1000
Shoot orientationerect
05DNA & barcoding70 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hypochaeris radicata has left across the world's sequence archives.
At a glance
DNA specimens70
Marker genes6
GenBank sequences10
eDNA detections43
Countries10
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATCGCGTCGCCCCC …
Hypochaeris radicata subsp. radicata voucher PLT.0305 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★trnL-F★ITS4★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Hypochaeris radicata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 467 000 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Hypochaeris radicata1.47 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 8 n = 4
Ploidy2× diploid · measured
Chromosome records8–82n range8median8mode59records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 859×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +13
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — CAPINERI R., D'AMATO G., MARCHI P. - 1976. Numeri cromosomici per la flora italiana:219-231.. Inform. Bot. Ital. , 8(1): 67-74.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Dvořák F. & Dadáková B., 1977a: Contribution to the karyological study of the species of Slovakian flora. - Biologia (Bratislava) 32/4: 243-254.
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3892
CCDB · poland — Pogan E., Jankun A., Sawicka Z. et al. 1989. Further studies in chromosome numbers of Polish Angiosperms. Part XXII. Acta Biol. Cracov. Ser. Bot. 31, 1-17.
CCDB · ipcn-api-dl — Izuzquiza, A. 1989. Números cromosomáticos de plantas occidentales, 533--538. Anales Jard. Bot. Madrid 45: 509–513.
CCDB · ipcn-api-dl — Barghi, N., C. Mugnier & S. Siljak-yakovlev. 1989. Karyological studies in some Hypochoeris spp. (Compositae) from Sicily. Pl. Syst. Evol. 168: 49–57.
CCDB · ipcn-api-dl — Sawicka, Z. 1989. Further studies in chromosome numbers of Polish angiosperms. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Parker, J. S., G. H. Jones, C. Tease & R. W. Palmer. 1976. Chromosome-specific control of chiasma formation in Hypochoeris and Crepis. Pp. 133--142 in K. Jones & P. E. Brandham (editors), Current Chromosome Research.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun & Z. Sawicka. 1990. Further studies in chromosome numbers of Polish angiosperms, part 22. Acta Biol. Cracov., Ser. Bot. 31: 1–17.
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
CCDB · ipcn-api-dl — Oberprieler, C. & R. Vogt. 1993. Chromosome numbers of north African phanerogams. II. Willdenowia 23: 211–238.
CCDB · ipcn-api-dl — Ruas, C. F., P. M. Ruas, N. I. Matzenbacher, G. Ross, C. Bernini & A. L. L. Vanzella. 1995. Cytogenetic studies of some Hypochoeris species (Compositae) from Brazil. Amer. J. Bot. 82(3): 369–375.
CCDB · ipcn-api-dl — Talavera, S., M. Arista, P. L. Ortiz & F. Bastida. 1994. Notas cariolo|3gicas sobre algunas compuestas de Marruecos. Acta Bot. Malac. 19: 97–101.
CCDB · ipcn-api-dl — Siljak-yakovlev, S. 1996. La dysplöidie et l'évolution du caryotype. Bocconea 5: 211–220.
CCDB · ipcn-api-dl — Valdés, B., R. Parra, A. M. Sánchez & M. D. Díaz. 1999. Números cromosómicos de plantas de Marruecos, IV. Lagascalia 21(1): 235–240.
CCDB · ipcn-api-dl — Valdés, B., R. Parra, R. Parrilla & C. Reina. 1998. Números cromosómicos de plantas de Marruecos. Lagascalia 20(2): 223–230.
CCDB · ipcn-api-dl — Dimitrova, D. 1999. Mediterranean chromosome number reports 9 (1055--1057). Fl. Medit. 9: 343–346.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.
CCDB · ipcn-api-dl — Parker, J. S. 1975. Chromosome-specific control of chiasma formation. Chromosoma 49: 39 1 –406.
CCDB · ipcn-api-dl — Parker, J. S. 1975a. Aneuploidy and isolation in two Hypochoeris species. Chromosoma 52: 89–101.
CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1978. Chromosome numbers in Taiwan Compositae. Bot. Bull. Acad. Sin. 19: 53–66.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Van Loon, J. C. & B. Kieft. 1980. In Chromosome number reports LXVIII. Taxon 29: 538–542.
CCDB · ipcn-api-dl — Adame, P. & S. Talavera. 1980. In Numeros cromosomicos para la flora Espahol. 121-182. Lagascalia 9: 249–284.
CCDB · ipcn-api-dl — Weiss, H., T. F. Stuessy, J. Grau & C. M. Baeza. 2003. Chromosome reports from South American Hypochaeris (Asteraceae). Ann. Missouri Bot. Gard. 90: 56–63.
CCDB · ipcn-api-dl — Baeza, C. M., G. Kottirsch, J. Espejo & R. Reinoso. 2001. Recuento cromosomicos en plantas que crecen en Chile. I. Gayana, Bot. 58(2): 133–137.
CCDB · ipcn-api-dl — Baeza, C. M., J. Grau, E. Vosyka, T. F. Stuessy & H. Weiss. 2000. Recuentos cromosomicos en especies de Hypochaeris L. (Asteraceae) de Chile. Gayana, Bot. 57(1): 105–106.
CCDB · ipcn-api-dl — Oberprieler, C. & R. Vogt. 2002. Hypochaeris arachnoidea Poir., a hitherto neglected species in NW Africa. Willdenowia 32: 231–236.
CCDB · ipcn-api-dl — Serra, C., B. Valdés, R. Marcucci & N. Tornadore. 2001. Mediterranean chromosome number reports 11 (1254--1263). Fl. Medit. 11: 466–473.
CCDB · ipcn-api-dl — Baeza, C. M. 2004. Recuentos cromosómicos en plantas que crecen en Chile. II. Darwiniana 42(1–4): 25–29.
CCDB · ipcn-api-dl — Tremetsberger, K. 2004. Relationship of Hypochaeris salzmanniana (Asteraceae, Lactuceae), an endangered species of the Iberian Peninsula, to H. radicata and H. glabra and biogeographical implications. Bot. J. Linn. Soc. 146: 79–95.
CCDB · ipcn-api-dl — Parker, J. S., R. W. Palmer, M. A. F. Whitehorn & L. A. Edgar. 1982a. Chiasma frequency effects of structural chromosome change. Chromosoma 85: 673–686.
CCDB · ipcn-api-dl — Strid, A. 1983. In IOPB chromosome number reports LXXVIII. Taxon 32: 138–140.
CCDB · ipcn-api-dl — Van Loon, J. C. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 763–764.
+18 more references
n 419×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74
CCDB · ipcn-api-dl — Jansen, R. K., T. F. Stuessy, S. Díaz-Piedrahíta & V. A. Funk. 1984. Recuentos cromosómicos en Compositae de Colombia. Caldasia 14(66): 7–20.
CCDB · ipcn-api-dl — Hunziker, J. H., C. C. Xifreda & A. F. Wulff. 1985. Estudios cromosómicos en angiospermas de Sudamérica. Darwiniana 26: 7–14.
CCDB · ipcn-api-dl — Luque, T., C. R. Zarco & J. A. Devesa. 1984. Números 321-330. In Números cromosómicos para la flora española. 300-364. Lagascalia 12: 286–290.
CCDB · ipcn-api-dl — Díez, M. J., J. Pastor & I. Fernández. 1984. Números cromosomáticos de plantas occidentales, 297--306. Anales Jard. Bot. Madrid 41: 191–194.
CCDB · ipcn-api-dl — Sun, B. y., T. F. Stuessy & D. J. Crawford. 1990. Chromosome counts from the flora of the Juan Fernández Islands, Chile III. Pacific Sci. 44: 258–264.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Gupta, R. C., B. S. Gill & R. K. Garg. 1989. Chromosomal conspectus of western Himalayan Compositae. Aspects Pl. Sci. 11: 427–437.
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Hunziker, J. H., A. Escobar, C. C. Xifred & J. C. Gamerro. 1990. Estudios cariologicos en Compositae. VI. Darwiniana 30: 115–121.
CCDB · ipcn-api-dl — Parker, J. S. 1975. Chromosome-specific control of chiasma formation. Chromosoma 49: 39 1 –406.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn67-71 — COLEMAN, R. 1968. Chromosome numbers in some Brazilian Compositae. Rhodora 70: 228-240.
CCDB · book-ipcn67-71 — DELAY, J. 1968. Orophytes d'Europe meridionale. Inf. Ann. Caryosyst. et Cytogenet. 2: 13-16.
CCDB · book-ipcn67-71 — DELAY, J. 1968. Halophytes II. Inf. Ann. Caryosyst. et Cytogenet. 2: 17-22.
CCDB · book-ipcn67-71 — POWELL, A.M., & R.M. KING. 1969. Chromosome numbers in the Compositae: Colombian species. Amer. J. Bot. 56: 116-121.
CCDB · book-ipcn73-74 — KAUL, V., & D. SINGH. 1972. Cytological studies in some members of Cichorieae (Compositael. Proc. Indian Sci. Congr. Assoc. 59( III): 366.
CCDB · book-ipcn73-74 — WITHERSPOON, J.T., C.G. SCHAACK, & T.J. WATSON JR. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.988 ↗
07Deep time~0 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type820 928 records
Wild obs. + sensor808 518
Museum / vouchered11 469
Cultivated / captive353
Other588
Origin
Native45 175
Introduced73 039
Range
Area of Occupancy AOO682 028 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy52% within 1 km
≤100 m 207 885≤1 km 158 085≤10 km 333 433>10 km 3 371
702 774 georeferenced · 105 744 without coordinates
Open the mapobservation + sensor808 518
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 953≤1 km 2 098≤10 km 3 094>10 km 214
6 359 georeferenced · 5 110 without coordinates
Open the institutions mapphysical evidence11 469
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2>10 km 11
13 georeferenced · 340 without coordinates
Open the mapnot free-living353
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions218 of 411 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 2 224 |
| BIO-UNIPIlocation not on record | 404 |
| LDlocation not on record | 295 |
| Olocation not on record | 259 |
| Adelaide, AU | 239 |
| Berlin, DE | 227 |
| Museo Entomologico de Leonlocation not on record | 163 |
| Pretoria, ZA | 163 |
| Bergen, NO | 155 |
| Christchurch, NZ | 154 |
| Mount Annan, AU | 147 |
| Hobart, AU | 147 |
| Salzburg, AT | 135 |
| València, ES | 132 |
| Canberra, AU | 132 |
| Entomological Society of Latvialocation not on record | 129 |
| WTUlocation not on record | 128 |
| Brisbane, AU | 112 |
| CICYTEXlocation not on record | 112 |
| Oskarshamn, SE | 107 |
| Odawara, JP | 105 |
| Moscow State Universitylocation not on record | 102 |
| Chongqing Museumlocation not on record | 97 |
| Auckland, NZ | 92 |
| Philadelphia, US | 90 |
| SLU Artdatabankenlocation not on record | 86 |
| BFLlocation not on record | 82 |
| South Kensington, GB | 79 |
| Pullman, US | 69 |
| Vancouver, CA | 68 |
| Saint Louis, US | 68 |
| Görlitz, DE | 64 |
| Corvallis, US | 64 |
| Bronx, US | 61 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 59 |
| Kensington, AU | 56 |
| Tartu, EE | 56 |
| ISAlocation not on record | 55 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 55 |
| KMNlocation not on record | 54 |
| BClocation not on record | 53 |
| Madrid, ES | 52 |
| Riverside, US | 51 |
| Trondheim, NO | 50 |
| Durban, ZA | 50 |
| CJBGlocation not on record | 49 |
| Williamsburg, US | 49 |
| Armidale, AU | 47 |
| BRNUlocation not on record | 46 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 44 |
| Salamanca, ES | 43 |
| Ann Arbor, US | 42 |
| DBF-NHMDlocation not on record | 39 |
| Universidad Nacional de Colombia (UNAL)location not on record | 37 |
| Nagano City, JP | 37 |
| Badajoz, ES | 37 |
| San Isidro, AR | 35 |
| Arcata, US | 35 |
| Davis, US | 34 |
| Bangkok, TH | 34 |
| University of Stellenboschlocation not on record | 34 |
| Wellington, NZ | 33 |
| Tsukuba, JP | 33 |
| Pamplona, ES | 32 |
| Santa Barbara, US | 30 |
| Frankfurt am Main | 29 |
| Claremont, US | 29 |
| Blumenau, BR | 29 |
| Kochi, JP | 29 |
| San Diego, US | 28 |
| NSMKlocation not on record | 28 |
| Fukushima Universitylocation not on record | 27 |
| College of the Atlantic, Museumlocation not on record | 27 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 26 |
| Canadian Department of Agriculturelocation not on record | 26 |
| Toyama, JP | 25 |
| Provincia di Livornolocation not on record | 24 |
| College Park, US | 24 |
| Wlocation not on record | 23 |
| Karlsruhe, DE | 23 |
| Shinshu Universitylocation not on record | 23 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 23 |
| San Luis Obispo, US | 23 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 23 |
| Dresden, DE | 22 |
| Santa Cruz, US | 21 |
| Moscow, US | 21 |
| CASlocation not on record | 20 |
| Córdoba, AR | 19 |
| Tokushima, JP | 19 |
| MAlocation not on record | 19 |
| Kew, GB | 19 |
| Universidad de La Salle (La Salle)location not on record | 18 |
| Bern, CH | 18 |
| Bando, JP | 18 |
| Victoria, CA | 18 |
| Philadelphia, US | 18 |
| Portland, US | 17 |
| Kawasaki Shi Tama Ku, JP | 16 |
| Natural History Museum Rotterdamlocation not on record | 15 |
| US | 15 |
| Stockholm, SE | 15 |
| Museo Achille Folettolocation not on record | 15 |
| Otaru, JP | 15 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 15 |
| UChlocation not on record | 14 |
| Allentown, US | 14 |
| BISHlocation not on record | 14 |
| Sevilla, ES | 14 |
| Universidad Católica de Oriente (UCO)location not on record | 14 |
| Rotorua, NZ | 14 |
| Staten Island, US | 14 |
| JP | 14 |
| Universidad de Antioquia (UdeA)location not on record | 14 |
| GJOlocation not on record | 14 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 14 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 13 |
| John T. Waterhouse Herbariumlocation not on record | 13 |
| MeiseBGlocation not on record | 13 |
| Cape Town, ZA | 13 |
| Laboratory of Palaeontologylocation not on record | 13 |
| Taipei, TW | 12 |
| Columbia, US | 12 |
| Criciúma, BR | 11 |
| New Haven, US | 11 |
| PrivatHerblocation not on record | 11 |
| Chapel Hill, US | 11 |
| UNESClocation not on record | 11 |
| Burlington, US | 11 |
| KIRMlocation not on record | 11 |
| Valdosta State Universitylocation not on record | 11 |
| Alicante, ES | 11 |
| Uppsala, SE | 10 |
| Zürich, CH | 10 |
| GAlocation not on record | 10 |
| Mlocation not on record | 10 |
| Boise, US | 10 |
| QVMAGlocation not on record | 10 |
| Mexico City, MX | 10 |
| Flagstaff, US | 10 |
| Norfolk, US | 10 |
| Québec, CA | 9 |
| Glarus, CH | 9 |
| Missoula, US | 9 |
| GZUlocation not on record | 9 |
| PUC-RSlocation not on record | 9 |
| Universidad de Caldas (UCaldas)location not on record | 9 |
| Pamplona, ES | 9 |
| Clemson, US | 9 |
| Parthenon Tama History Museumlocation not on record | 9 |
| Jena Microbial Resource Collectionlocation not on record | 9 |
| Sagamihara, JP | 9 |
| China Agricultural Universitylocation not on record | 8 |
| Wuzhou, CN | 8 |
| Tilburg, NL | 8 |
| Valparaiso, CL | 8 |
| Acadia Universitylocation not on record | 8 |
| Dekalb, US | 8 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 8 |
| EL PASO, US | 8 |
| Smithfield, AU | 8 |
| Anchorage, US | 8 |
| Ashland, US | 8 |
| Bloomington, US | 8 |
| Madison, US | 8 |
| Taipei, TW | 7 |
| Paris, FR | 7 |
| BSBIlocation not on record | 7 |
| Sanda, JP | 7 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 7 |
| J.F.Oberlin Universitylocation not on record | 7 |
| New Brunswick, US | 7 |
| KOMlocation not on record | 7 |
| University of New Hampshirelocation not on record | 7 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 7 |
| Oulu, FI | 7 |
| University of Alberta Museumslocation not on record | 6 |
| TAIElocation not on record | 6 |
| Palmerston North, NZ | 6 |
| Akita Prefectural Museumlocation not on record | 6 |
| Johnson City, US | 6 |
| Phyletisches Museum Jenalocation not on record | 6 |
| Knoxville, US | 6 |
| Taipei, TW | 6 |
| Kagoshima, JP | 6 |
| National Institute of Biological Resourceslocation not on record | 6 |
| Tomioka, JP | 6 |
| Beijing, CN | 5 |
| SIHUlocation not on record | 5 |
| Tacoma, US | 5 |
| Batemans Bay, AU | 5 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 5 |
| Tallinn, EE | 5 |
| Irvine, US | 5 |
| Parkville, AU | 5 |
| Montréal, CA | 5 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 5 |
| San José, CR | 5 |
| US | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| La Trobe Universitylocation not on record | 5 |
| Logan, US | 5 |
| Washington, US | 4 |
| Frauenfeld, CH | 4 |
| Little Rock, US | 4 |
| Ishikawa Museum of Natural Historylocation not on record | 4 |
| ASUlocation not on record | 4 |
| Turlock, US | 4 |
| Pittsburg, US | 4 |
| Université Lavallocation not on record | 4 |
| Jackson, US | 4 |
| Fairfax, US | 4 |
| Elikins, US | 4 |
| University of North Carolina at Pembrokelocation not on record | 4 |
| UTFPR-CPlocation not on record | 3 |
| QCNElocation not on record | 3 |
| UFSClocation not on record | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 3 |
| Western Carolina Universitylocation not on record | 3 |
| Palmerston, AU | 3 |
| TROMlocation not on record | 3 |
| Minia, EG | 3 |
| Bourges, FR | 3 |
| National Museum Waleslocation not on record | 3 |
| Turku, FI | 3 |
| JBRJlocation not on record | 3 |
| DASSHlocation not on record | 3 |
| Phoenix, US | 3 |
| HUAlocation not on record | 3 |
| Texas Lutheran Universitylocation not on record | 3 |
| Portland, US | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| James Cook Townsvillelocation not on record | 3 |
| HJAEFlocation not on record | 3 |
| Gijón, ES | 3 |
| PRClocation not on record | 3 |
| Omachi Alpine Museumlocation not on record | 3 |
| Helsinki, FI | 3 |
| Porto Alegre, BR | 3 |
| Castelar, AR | 3 |
| Fredericksburg, US | 3 |
| nbflocation not on record | 3 |
| AUAlocation not on record | 3 |
| Tuscaloosa, US | 3 |
| University of Genevalocation not on record | 3 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 3 |
| Universidade Federale do Rio Grande do Sullocation not on record | 3 |
| Aarhus, DK | 3 |
| Mount Berry, US | 3 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 3 |
| Campo Mourão, BR | 3 |
| CUVClocation not on record | 3 |
| UDESC-CAVlocation not on record | 3 |
| Los Angeles, US | 3 |
| Henderson, US | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Emporia, US | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Bozeman, US | 2 |
| *unvoucheredlocation not on record | 2 |
| Due West, US | 2 |
| Hiratsuka City Museumlocation not on record | 2 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 2 |
| Millersville, US | 2 |
| Herb. BBGlocation not on record | 2 |
| Viña del Mar, CL | 2 |
| Granada, ES | 2 |
| Cheney, US | 2 |
| Durango, MX | 2 |
| Edmonton, CA | 2 |
| Jaén, ES | 2 |
| Tampa, US | 2 |
| Whitehorse, CA | 2 |
| Sendai, JP | 2 |
| Chadron, US | 2 |
| Zürich, CH | 2 |
| University of Tennessee at Chattanoogalocation not on record | 2 |
| Tempe, US | 2 |
| Felix d'Herelle Reference Center for Bacterial Viruseslocation not on record | 2 |
| Fundación Miguel Lillolocation not on record | 2 |
| Trois-Rivières, CA | 2 |
| Ciudad Autónoma de Buenos Aires, AR | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| OLAlocation not on record | 2 |
| UGentlocation not on record | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Xiamen, CN | 2 |
| Conway, US | 2 |
| KNAMlocation not on record | 2 |
| IAvHlocation not on record | 2 |
| Nijmegen, NL | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Coimbra, PT | 2 |
| Valparaíso, CL | 2 |
| McWane Science Centerlocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Sapporo, JP | 2 |
| St. Paul, US | 2 |
| Foz do Iguaçu, BR | 2 |
| Caldwell, US | 2 |
| Córdoba, ES | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Long Beach, US | 2 |
| Maryland Department of Natural Resourceslocation not on record | 2 |
| Porrentruy, CH | 2 |
| FUVATESlocation not on record | 2 |
| San Bernardino, US | 2 |
| UFPRlocation not on record | 2 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 2 |
| Edinburgh, GB | 2 |
| Fort Worth, US | 2 |
| Universidade da Região de Joinville - Univillelocation not on record | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| Tall Timbers Research Stationlocation not on record | 2 |
| Fayetteville, US | 2 |
| INMAlocation not on record | 1 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 1 |
| Fulda, DE | 1 |
| UNIVILLElocation not on record | 1 |
| Bend, US | 1 |
| Cascavel, BR | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| BGPAlocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| Wayland Universitylocation not on record | 1 |
| BMlocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Denton, US | 1 |
| UNISANTAlocation not on record | 1 |
| La Paz, BO | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Ypsilanti, US | 1 |
| Kingston, US | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 1 |
| Plocation not on record | 1 |
| Hudson, US | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| MSB-3054location not on record | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Nishihara, JP | 1 |
| INTAlocation not on record | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| Asheville, US | 1 |
| GB | 1 |
| Chicago, US | 1 |
| Glocation not on record | 1 |
| Nishihara, JP | 1 |
| H-AkrKGlocation not on record | 1 |
| LfUlocation not on record | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| Elocation not on record | 1 |
| MEDELlocation not on record | 1 |
| Saint John, CA | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Philadelphia, US | 1 |
| UNICAMPlocation not on record | 1 |
| Sion, CH | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| UFABClocation not on record | 1 |
| Londrina, BR | 1 |
| UFMSlocation not on record | 1 |
| Podgorica, ME | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Stellenbosch University, DST- NRF Centre of Excellence for Invasion Biologylocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Zapopan, MX | 1 |
| Quito, EC | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| SJNAlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Mississippi State, US | 1 |
| UTPLlocation not on record | 1 |
| BGBMlocation not on record | 1 |
| Oswego, US | 1 |
| Toronto, CA | 1 |
| Universidad del Valle (UV)location not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Morgantown, US | 1 |
| Bothell, US | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Durham, US | 1 |
| Universidade Federal de Pelotaslocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| Northridge, US | 1 |
| San Angelo, US | 1 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 1 |
| Conway, US | 1 |
| GHPG$location not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Brussel, BE | 1 |
| Austin, US | 1 |
| Catalina Island Conservancylocation not on record | 1 |
| San Jose, US | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Pocatello, US | 1 |
| Göteborg, SE | 1 |
| South African National Biodiversity Institute, Compton Herbariumlocation not on record | 1 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 1 |
| GNWPlocation not on record | 1 |
| Provo, US | 1 |
| Brasília, BR | 1 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 1 |
411 institutions · 10 157 of 11 469 vouchered records shown · 958 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA43 detections
Where the DNA of Hypochaeris radicata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found43
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 43 detections have coordinates
Open the map9 countries0
Annual grasseson grassy road vergeJust off pavement edge on west side of road.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.9 °C 10.2–19.6
Seasonal swing summer↔winter15.0 °C
Max temp (day)18.7 °C 13.2–23.5
Min temp (night)10.5 °C 6.40–14.8
Precipitation75.9 mm/mo 50.2–123
Air humidity62.0 % 52.9–66.2
Moisture balance-31.0 mm/mo
Vapour deficit678 Pa 420–979
Wind speed3.30 m/s
Cloud cover41.2 % 29.3–51.4
CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.