Hyphoraia testudinaria

Geoffroy, 1785 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Hyphoraia

At a glance

Occurrence records1 088

Data sources6

Biological traits0

DNA specimens9

eDNA detections1

Sources6 archives

Databases and archives Hyphoraia testudinaria's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 088 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 088 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD9 specimens

01Narrative

Hyphoraia testudinaria is een vlinder uit de familie van de spinneruilen (Erebidae), onderfamilie beervlinders (Arctiinae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1785 door Geoffroy in Fourcroy. Deze nachtvlinder komt voor in Europa.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hyphoraia testudinaria has left across the world's sequence archives.

At a glance

DNA specimens9

BINs3

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)1.0%

Haplotypes2

BINs3

Most divergent pair1.2%

Where individuals differ — all 16 variable positions, in barcode order

4Avariable

25Avariable

76Amostly conserved

94Cvariable

115Tvariable

202Tmostly conserved

214Avariable

352Tvariable

365Gmostly conserved

397Cmostly conserved

424Tvariable

455Gvariable

517Avariable

541Tmostly conserved

613Tmostly conserved

631Tvariable

ATTATACTTTATCTTTGGAGTTTGAGCAGGAATAGTAGGAACTTCCTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATCTTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctia dejeanisame family4.4%Hyphoraia dejeanisame genus4.4%Pararctia lapponicasame family6.0%Pararctia yarrowiisame family6.1%Palearctia glaphyrasame family6.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 088 records

Wild obs. + sensor757

Museum / vouchered248

Other83

Origin

Native340

Range

Area of Occupancy AOO1 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy12% within 1 km

≤100 m 53≤1 km 29≤10 km 625>10 km 2

709 georeferenced · 48 without coordinates

Open the mapobservation + sensor757

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤100 m 1≤1 km 12≤10 km 213>10 km 9

235 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence248

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	85
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	24
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	20
Bern, CH	12
Nijmegen, NL	6
Tiroler Landesmuseum Ferdinandeumlocation not on record	3
UMUlocation not on record	3
Tiroler Landesmuseum Ferdinandeumlocation not on record	2
Musee d'Histoire Naturallelocation not on record	2
Provincia di Livornolocation not on record	2
Dhaka, BD	2
Natural History Museum Rotterdamlocation not on record	2
Philadelphia, US	1
Tartu, EE	1

14 institutions · 165 of 248 vouchered records shown · 83 without an institution code

09Environmental DNA1 detections

Where the DNA of Hyphoraia testudinaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter21.1 °C

Max temp (day)14.5 °C

Min temp (night)3.50 °C

Precipitation197 mm/mo

Air humidity63.6 %

Moisture balance81.8 mm/mo

Vapour deficit446 Pa

Wind speed4.10 m/s

Cloud cover37.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hyphoraia testudinaria

At a glance

Sources6 archives

At a glance

Record type1 088 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 088 records