Hyphessobrycon sweglesi

(Géry, 1961) · species

image placeholder — illustration coming later

Animalia/Chordata/Characiformes/Characidae/Hyphessobrycon

At a glance

Occurrence records215

Data sources8

Biological traits5

DNA specimens22

eDNA detections21

Sources8 archives

Databases and archives Hyphessobrycon sweglesi's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility215 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF215 records

Environmental DNA1 datasets · 1 countries21 detections

DNA & barcodingBOLD22 specimens

01Narrative

Hyphessobrycon sweglesi is a species of tetra that lives in the Orinoco River drainage basin in South America. The fish has a round black spot behind the gill-plate, a black band on the dorsal fin that is bordered above and below by creamy-white. The other fins are red same as the upper rim of the eye. The fish eats worms, small insects, and crustaceans. The species can lay up to 400 eggs that can hatch in a day and that are susceptible to fungus. The species' appearance is very similar to Hyphessobrycon megalopterus (black phantom tetra). The species' scientific name used to be Megalamphodus sweglisi and the species' common name is red phantom tetra.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length3.2 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability10

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hyphessobrycon sweglesi has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes1

eDNA detections21

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.32%

Haplotypes2

BIN1

Most divergent pair3.4%

ATATTCGGCGCCTGGGCCGGCATAGTTGGAACAGCCCTAAGCCTTCTGATCCGGGCAGAGCTCGGACAACCGGGGGCTCTCTTGGGAGAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hyphessobrycon epicharissame genus3.8%Hyphessobrycon rosaceussame genus6.3%Hemigrammus erythrozonussame family14.6%Hyphessobrycon santaesame genus15.9%Batasio batasiosame order17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type215 records

Wild obs. + sensor34

Museum / vouchered181

Origin

Native1

Range

Area of Occupancy AOO648 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 34 records without

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤1 km 12≤10 km 5>10 km 3

20 georeferenced · 161 without coordinates

Open the institutions mapphysical evidence181

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	47
Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record	25
Pontificia Universidad Javeriana (PUJ)location not on record	16
Instituto de Biodiversidad de Venezuela - INBIOlocation not on record	15
Montgomery, US	14
Universidad del Tolima (UT)location not on record	13
Museu de Zoologia da Universidade de Sao Paulolocation not on record	9
University of Nebraskalocation not on record	9
UNICAMPlocation not on record	9
USP-RPlocation not on record	8
Stockholm, SE	4
Universidad de los Llanos (UniLlanos)location not on record	3
PUC-RSlocation not on record	3
UEMlocation not on record	1
Cambridge, US	1
Geneva, CH	1
Instituto Nacional de Pesquisas da Amazonialocation not on record	1
	1
Chicago, US	1

19 institutions · 181 of 181 vouchered records shown

09Environmental DNA21 detections

Where the DNA of Hyphessobrycon sweglesi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.6 °C 26.6–27.5

Seasonal swing summer↔winter1.60 °C

Max temp (day)30.2 °C 29.6–30.2

Min temp (night)23.9 °C 23.5–24.6

Precipitation160 mm/mo 124–170

Air humidity70.3 % 68.1–72.1

Moisture balance34.9 mm/mo -25.5–39.4

Vapour deficit1,030 Pa 966–1,156

Wind speed0.9 m/s 0.8–0.9

Cloud cover61.2 % 37.1–61.4

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)