Hypericum maculatum
Crantz · speciesAt a glance
Occurrence records204 308
Data sources11
Biological traits41
DNA specimens37
eDNA detections47
Sources11 archives
Databases and archives Hypericum maculatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility204 308 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics37 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Chemical compositionLOTUS54 compounds
Occurrence & distributionGBIF204 308 records
Environmental DNA2 datasets · 4 countries47 detections
DNA & barcodingBOLD · NCBI37 specimens
Genome at a glanceCCDB · GoaT939 Mbp
01Narrative
Le Millepertuis taché ou Millepertuis maculé est une espèce de plantes à fleurs de la famille des Clusiacées selon la classification classique de Cronquist (1981) ou des Hypéricacées selon la classification phylogénétique APG III (2009). C'est une plante herbacée vivace trouvée en Europe et dans l'ouest de l'Asie, où elle pousse dans des prairies humides.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass18.5 mg
Leaf size217 mm²
⚠ sources differ — TRY: 217 mm² · LEDA: 731 mm² · GIFT: 731 mm²
Plant height0.398 m
⚠ sources differ — GIFT: 0.398 m · LEDA: 0.434 m · TRY: 0.425 m
Plant height generative0.298 m
Plant height max0.8 m
Plant height min0.2 m
Seed length0.827 mm
Seed mass0.03 mg
⚠ sources differ — TRY: 0.03 mg · LEDA: 0.073 mg · GIFT: 0.088 mg
Seed mass max0.08 mg
Seed mass min0.01 mg
Life cycle & reproduction13
Deciduousnesssemi-evergreen
Dehiscencedehiscent
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flowering endAug
Flowering startJul
Life formperennial
Life spanperennial
Lifespan years5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Seed number5 457
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf c481 mg/g
Leaf dry-matter content (LDMC)334 mg/g
⚠ sources differ — TRY: 334 mg/g · LEDA: 265 mg/g
Leaf n25.2 mg/g
Leaf p1.81 mg/g
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)19.1 mm²/mg
⚠ sources differ — TRY: 19.1 mm²/mg · LEDA: 25.21 mm²/mg · GIFT: 24.98 mm²/mg
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition54 compounds
Compounds documented for Hypericum maculatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Hydrocarbons13
Flavonols12
Anthraquinones and anthrones7
Unsaturated fatty acids7
Branched fatty acids $ Unsaturated fatty acids4
Documented compounds54 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one | present | LOTUS | |
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3S,4R,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-4-oxo-4H-1-benzopyran-3-yl 6-deoxyhexopyranoside | present | LOTUS | |
| alpha-Catechin | present | LOTUS | |
| Amentoflavone | present | LOTUS | |
| Avicularin | present | LOTUS | |
| Behnic acid | present | LOTUS | |
| Carnaubic acid | present | LOTUS | |
| Catechin | present | LOTUS |
05DNA & barcoding37 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hypericum maculatum has left across the world's sequence archives.
At a glance
DNA specimens37
Marker genes6
GenBank sequences9
eDNA detections47
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGCCTGCCTGGGTGTCACACATC …
Hypericum maculatum voucher 413701a1HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL6★rbcLa★ITS3★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Hypericum maculatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size938 880 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Hypericum maculatum0.94 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records16–322n range16median16mode42records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1634×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · iapt +10
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Mártonfi P., 2001: New species of the genus Hypericum sect. Hypericum (Guttiferae) from Slovakia. - Folia Geobotanica 36/4: 371-384.
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · brit-fl — Robson, N.K.B. (1956)
CCDB · fl-europaea — V. Sorsa, 1962
CCDB · poland — Pogan E., Rychlewski J. et al. 1980 a. Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov. Ser. Bot. 22, 129-153.
CCDB · ipcn-api-dl — Laane, M. M. & T. Lie. 1985. Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7–15.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.
CCDB · ipcn-api-dl — Pogan, E. 1980. Further studies in chromosome numbers of Polish Angiosperms. Acta Biol. Cracov., Ser. Bot. 22: 129–153.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2008. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 3. Kochia 3: 55–60.
CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2009. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 4. Kochia 4: 37–46.
CCDB · book-ipcn67-71 — ZHUKOVA, P. G. 1967. Karyology of some plants, cultivated in the Arctic-Alpine Botanical Garden. (In Russian). In N. A. Avrorin (ed.): Plantarum in Zonam Polarem Transportatio. II. Leningrad 1967, pp. 139-149.
CCDB · book-northern-plants — Winge 1925.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-fedorov — Nielsen 1924
CCDB · book-fedorov — Gustafsson 1947a
CCDB · book-atlas-flowering-plants — Noack 1939
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Dmitrieva, S. A. (1986b). Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapovedniki Belorussii Issledovaniia 10: 24-28.
CCDB · CromoCat 2015 — Laane, M. M. & Lie, T. (1985). Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7-15.
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1987). Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II Zapovedniki Belorussii Issledovaniia 11: 62-69.
CCDB · CromoCat 2015 — Pashuk, K. T. (1987). Chromosome number in species of subalpine belt of Chernogora (Ukrainian Carpathians). Bot. Žurn. 72(8): 1069-1074.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · iapt — IAPT/IOPB Chromosome Data 22
2n 328×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · nw-europe-fl +3
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Robson, N.K.B. (1956)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2119
CCDB · fl-europaea — Robson
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Mártonfi, P., J. Michálek, J. Hadinec, L. Mártonfiová & M. Repčák. 1999. Hypericum dubium---a new species of the Czech flora. Preslia 71: 337–348.
CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2009. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 4. Kochia 4: 37–46.
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
n 83×CCDB · book-ipcn67-71 · CCDB · Cave1963 · CCDB · CromoCat 2015
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Meiosis and structural hybridity in some Norwegian plant species. Blyttia 27: 141-173.
CCDB · Cave1963 — Sorsa 1962
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type204 308 records
Wild obs. + sensor190 551
Museum / vouchered10 508
Cultivated / captive43
Other3 206
Origin
Native6 272
Introduced12
Range
Area of Occupancy AOO308 812 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy69% within 1 km
≤100 m 65 026≤1 km 46 281≤10 km 49 081>10 km 729
161 117 georeferenced · 29 434 without coordinates
Open the mapobservation + sensor190 551
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 1 733≤1 km 2 516≤10 km 3 852>10 km 686
8 787 georeferenced · 1 721 without coordinates
Open the institutions mapphysical evidence10 508
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 14
14 georeferenced · 29 without coordinates
Open the mapnot free-living43
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions59 of 123 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 947 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 723 |
| Helsinki, FI | 593 |
| Olocation not on record | 456 |
| Salzburg, AT | 306 |
| LDlocation not on record | 303 |
| Moscow State Universitylocation not on record | 290 |
| Oulu, FI | 210 |
| Trondheim, NO | 172 |
| Bergen, NO | 153 |
| Oskarshamn, SE | 143 |
| Jyväskylä, FI | 119 |
| Turku, FI | 106 |
| TROMlocation not on record | 103 |
| MeiseBGlocation not on record | 99 |
| SLU Artdatabankenlocation not on record | 98 |
| KMNlocation not on record | 84 |
| DBF-NHMDlocation not on record | 78 |
| BRNUlocation not on record | 58 |
| BFLlocation not on record | 56 |
| TUR-Alocation not on record | 51 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 49 |
| Tartu, EE | 47 |
| GZUlocation not on record | 47 |
| Görlitz, DE | 44 |
| Adam Mickiewicz University in Poznańlocation not on record | 41 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 38 |
| BDBClocation not on record | 38 |
| Provincia di Livornolocation not on record | 36 |
| GJOlocation not on record | 33 |
| Porvoo, FI | 31 |
| Mlocation not on record | 29 |
| Wlocation not on record | 26 |
| KFGBlocation not on record | 26 |
| Kuopio, FI | 25 |
| Dresden, DE | 25 |
| Tallinn, EE | 23 |
| Uniwersytet Warszawskilocation not on record | 21 |
| Uniwersytet Jagiellońskilocation not on record | 21 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 20 |
| Zürich, CH | 18 |
| Berlin, DE | 17 |
| Uppsala, SE | 17 |
| Barcelona, ES | 16 |
| South Kensington, GB | 15 |
| Karlsruhe, DE | 13 |
| MAlocation not on record | 11 |
| Museo Entomologico de Leonlocation not on record | 10 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 9 |
| València, ES | 9 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 9 |
| Zürich, CH | 9 |
| Porrentruy, CH | 8 |
| Nijmegen, NL | 8 |
| National Museum Waleslocation not on record | 8 |
| Tula State Universitylocation not on record | 7 |
| Frankfurt am Main | 7 |
| Stockholm, SE | 6 |
| Uniwersytet Śląski w Katowicachlocation not on record | 6 |
| Rovaniemi, FI | 6 |
| Philadelphia, US | 6 |
| PRClocation not on record | 6 |
| Fulda, DE | 5 |
| Kandalaksha State Nature Reservelocation not on record | 5 |
| Glarus, CH | 5 |
| Vancouver, CA | 5 |
| Bloomington, US | 5 |
| Forssa, FI | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| BClocation not on record | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 4 |
| Herb. BBGlocation not on record | 4 |
| College Park, US | 3 |
| nbflocation not on record | 3 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 3 |
| SWlocation not on record | 3 |
| Frauenfeld, CH | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Kostrzyca Forest Gene Banklocation not on record | 3 |
| NoColllocation not on record | 3 |
| John May Museum of Natural Historylocation not on record | 2 |
| Philadelphia, US | 2 |
| Sion, CH | 2 |
| BSBIlocation not on record | 2 |
| Paris, FR | 2 |
| H-Schuhwlocation not on record | 2 |
| Salamanca, ES | 2 |
| Tromso University Museumlocation not on record | 1 |
| Toronto, CA | 1 |
| Monastir, TN | 1 |
| Kew, GB | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Bangkok, TH | 1 |
| Staten Island, US | 1 |
| H-AkrKGlocation not on record | 1 |
| Chicago, US | 1 |
| IDElocation not on record | 1 |
| SZUlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Logan, US | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Saint Louis, US | 1 |
| Jaén, ES | 1 |
| Christchurch, NZ | 1 |
| Umeå Universitylocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| CZE061location not on record | 1 |
| Whitewater, US | 1 |
| Whitehorse, CA | 1 |
| Podgorica, ME | 1 |
| Xiamen, CN | 1 |
| NMBU:MINAlocation not on record | 1 |
| Dekalb, US | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Alicante, ES | 1 |
| FLADlocation not on record | 1 |
| Garðabær, IS | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Victoria, CA | 1 |
| ULBF-AGRlocation not on record | 1 |
| 1 | |
| Montréal, CA | 1 |
123 institutions · 10 109 of 10 508 vouchered records shown · 260 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA47 detections
Where the DNA of Hypericum maculatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found47
Studies independent surveys2
Countries4
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 47 detections have coordinates
Open the map4 countries0
in semi-natural woodland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median7.70 °C 7.40–15.7
Seasonal swing summer↔winter21.6 °C
Max temp (day)11.1 °C 10.6–18.6
Min temp (night)5.00 °C 4.70–12.6
Precipitation40.4 mm/mo 40.4–87.5
Air humidity65.1 % 61.3–65.4
Moisture balance-2.90 mm/mo -27.0–16.2
Vapour deficit367 Pa 360–632
Wind speed4.60 m/s 3.60–4.70
Cloud cover46.1 % 46.1–52.2
CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.