Hypericum adenotrichum

Spach · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Hypericaceae/Hypericum

At a glance

Occurrence records2

Data sources9

Biological traits2

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Hypericum adenotrichum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility2 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF2 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Hypericum adenotrichum, commonly known as kantaron, is a species of perennial flowering plant in the family Hypericaceae. It is native to Turkey.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formsubshrub

Habitat & environment1

Climatetemperate

03Chemical composition5 compounds

Compounds documented for Hypericum adenotrichum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Flavonols2

Flavones1

Anthraquinones and anthrones1

Monosaccharides1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
D-Fructose	present	LOTUS
Hypericin	present	LOTUS
Hyperin	present	LOTUS
Luteolin 7-diglucoside	present	LOTUS
Quercetin	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hypericum adenotrichum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSHE653400.1 ↗651 bp

ACGT

TCGAAACCTCCCAAATGACCCGCGAACTAGTTATCCACAAGTCGGGGGTGTCGTGGGGCTTCTGTCCCTGGCGCTCCCGTGCCGGTGGTG …

Hypericum adenotrichum genomic DNA containing ITS1, 5.8S rRNA gene, ITS2, specimen voucher Cultivated 1981-35 (Kew-Wakehurst)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hypericum adenotrichum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 188×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 +3

CCDB · ipcn-api-dl — Van Loon, J. C. & A. K. V. Setten. 1982. IN: IOPB Plant chromosome number reports. Taxon 31: 589–592.

CCDB · ipcn-api-dl — LOON VAN, J. C. & H. D. JONG. 1978. In IOPB chromosome number reports LIX. Taxon 27: 53–61.

CCDB · book-ipcn67-71 — CONTANDRIOPOULOS, J., & M. LANZALAVI. 1968. Contribution a l'etude cytotaxinomique des Hypericum de Grece. Bull. Soc. Bot. France 115: 5-14.

CCDB · book-ipcn75-78 — Loon & Jong 1978

CCDB · book-ipcn73-74 — REYNAUD, C. 1973. Contribution a l'etude cytotaxinomique du genre Hypericum L. en Turquie. I Bull. Soc. Bot. France 120: 201-216. i

CCDB · book-fedorov — Sugiura 1940d, 1944

CCDB · book-fedorov — D. 1955)

CCDB · book-atlas-flowering-plants — Sugiura 1944

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.992 ↗

08Occurrence & distribution

Record type2 records

Museum / vouchered2

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Dresden, DE	1
South Kensington, GB	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Hypericum adenotrichum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)