Hypelate trifoliata

Sw. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Sapindales/Sapindaceae/Hypelate

At a glance

Occurrence records247

Data sources9

Biological traits15

DNA specimens5

eDNA detections3

Sources9 archives

Databases and archives Hypelate trifoliata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility247 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF247 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Гипелате (лат. Hypelate) — монотипный род деревянистых растений семейства Сапиндовые (Sapindaceae). Включает единственный вид — Гипелате трёхлистное, или белое.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height13.11 m

Seed mass141 mg

Life cycle & reproduction4

Deciduousnessevergreen

Dispersal typeanimal

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Leaf p0.5 mg/g

Specific leaf area (SLA)6.65 mm²/mg

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hypelate trifoliata has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences6

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKJ082366.1 ↗411 bpPuerto Rico · 2011

ACGT

CCGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGTAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCCC …

Hypelate trifoliata voucher 0118737322 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type247 records

Wild obs. + sensor85

Museum / vouchered162

Range

Area of Occupancy AOO592 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 55≤1 km 3≤10 km 2>10 km 14

74 georeferenced · 11 without coordinates

Open the mapobservation + sensor85

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 3≤1 km 7≤10 km 21>10 km 16

47 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence162

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	43
Miami, US	29
Saint Louis, US	16
NHMJlocation not on record	6
Kew, GB	6
Fredericksburg, US	5
University of Stellenboschlocation not on record	5
Tampa, US	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Berlin, DE	2
Fort Worth, US	2
Uniwersytet Śląski w Katowicachlocation not on record	1
Tempe, US	1
South Kensington, GB	1
Institut de Biologia Evolutiva, (CSIC-UPF)location not on record	1
Bloomington, US	1
Montréal, CA	1

17 institutions · 127 of 162 vouchered records shown · 35 without an institution code

09Environmental DNA3 detections

Where the DNA of Hypelate trifoliata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)