Hypecoum procumbens

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Hypecoum

At a glance

Occurrence records1 694

Data sources7

Biological traits13

DNA specimens2

eDNA detections1

Sources7 archives

Databases and archives Hypecoum procumbens's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 694 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF1 694 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height0.4 m

Seed mass1.14 mg

Life cycle & reproduction4

Life formannual

Life spanannual

Lifespan years1 years

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hypecoum procumbens has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ917165.1 ↗568 bp

ACGT

TCGAAACCTGCCCAGCAGAACGACCCGCGAACGCGTCACCGAGCCGGGGACGGTAGCGTCGAGAGGCGCGGCCTCCCCGTTCCGCCTGGG …

Hypecoum procumbens voucher Borza et al. s.n. (PE) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 694 records

Wild obs. + sensor1 430

Museum / vouchered257

Other7

Origin

Native43

Range

Area of Occupancy AOO2 632 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy51% within 1 km

≤100 m 485≤1 km 174≤10 km 584>10 km 52

1 295 georeferenced · 135 without coordinates

Open the mapobservation + sensor1 430

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 7≤1 km 65≤10 km 48>10 km 3

123 georeferenced · 134 without coordinates

Open the institutions mapphysical evidence257

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	46
Barcelona, ES	18
València, ES	17
MAlocation not on record	16
Saint Louis, US	8
BClocation not on record	8
BDBClocation not on record	7
Paris, FR	6
Adam Mickiewicz University in Poznańlocation not on record	4
Institut und Museum fuer Geologie und Palaeontologielocation not on record	4
University of Patraslocation not on record	4
Moscow State Universitylocation not on record	4
Jaén, ES	4
Madrid, ES	4
Wlocation not on record	4
ISAlocation not on record	3
LDlocation not on record	3
Phyletisches Museum Jenalocation not on record	3
Alicante, ES	3
Entomological Society of Latvialocation not on record	3
Auckland, NZ	3
Uniwersytet Jagiellońskilocation not on record	2
BRNUlocation not on record	2
Pamplona, ES	2
Frankfurt am Main	2
JBSlocation not on record	2
Oskarshamn, SE	1
Natural History Museum Rotterdamlocation not on record	1
College of the Atlantic, Museumlocation not on record	1
Kew, GB	1
Tilburg, NL	1
BG-NMNHSlocation not on record	1
Salamanca, ES	1
Davis, US	1
PRClocation not on record	1
Wellington, NZ	1
Museo della Bonifica di San Donà di Piavelocation not on record	1
UniKSlocation not on record	1
UIBlocation not on record	1

39 institutions · 195 of 257 vouchered records shown · 62 without an institution code

09Environmental DNA1 detections

Where the DNA of Hypecoum procumbens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hypecoum procumbens

At a glance

Sources7 archives

Size & morphology2

Life cycle & reproduction4

Diet & foraging1

Habitat & environment5

Physiology & chemistry1

At a glance

Record type1 694 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 694 records