Hypecoum erectum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Hypecoum

At a glance

Occurrence records565

Data sources12

Biological traits26

DNA specimens6

eDNA detections2

Sources12 archives

Databases and archives Hypecoum erectum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility565 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Chemical compositionLOTUS · NPASS14 compounds

Occurrence & distributionGBIF565 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB · GoaT · NCBI≈203 Mbp

01Narrative

角茴香（学名：）为罂粟科角茴香属下的一个种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Fruit length50 mm

Fruit length max60 mm

Fruit length min40 mm

Fruit width1.25 mm

Fruit width max1.5 mm

Fruit width min1 mm

Plant height0.225 m

Plant height max0.3 m

Plant height min0.15 m

Seed mass195 mg

Life cycle & reproduction6

Flowering endAug

Flowering startMay

Life formannual

Life spanannual

Raunkiær life formtherophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 200 m

Elevation mean800 m

Elevation min400 m

Growth formherb

Habitat GIFTforest, inhabited places, sand, steppe, stony places

Woodinessnon-woody

03Chemical composition14 compounds

Compounds documented for Hypecoum erectum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoquinoline alkaloids6

Isoquinoline alkaloids $ Protopine alkaloids3

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids1

Protoberberine alkaloids1

Carboline alkaloids1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(5S)-6-methylspiro[7,8-dihydro-[1,3]dioxolo[4,5-g]isoquinoline-5,7'-9H-[1,3]dioxolo[4,5-h]isochromene]-6'-one	present	LOTUS
3-Methyl-6H-indolo[3,2,1-de][1,5]naphthyridin-2,6-dione	present	NPASS
6'-Methylspiro[6,9-dihydro-[1,3]dioxolo[4,5-h]isochromene-7,5'-7,8-dihydro-[1,3]dioxolo[4,5-g]isoquinoline]	present	LOTUS
alpha-Allocryptopine	present	LOTUS
Coptisine	present	LOTUS
Corydamine	present	LOTUS
Hypecorinine	present	LOTUS
Hyperectine	present	LOTUS
IPABSWBNWMXCHM-VGSWGCGISA-N	present	NPASS
Isohyperectine	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hypecoum erectum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes4

GenBank sequences10

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOQ917161.1 ↗568 bp

ACGT

TCGATACCTGCCCAGCAGAACGACCCGTGAACTTGTCATCCCGCACGGGGGGATCGTGCCTAAATGGGTCCGACCCCCCGCTCCGCCCGC …

Hypecoum erectum voucher Hou YT 2008001 (PE) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL5★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT · NCBI

The complete instruction manual Hypecoum erectum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈202 645 716 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Hypecoum erectum0.20 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 164×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1

CCDB · iapt — IAPT/IOPB Chromosome Data 13

CCDB · ipcn-api-dl — Dahl, Å. E. 1990. Infrageneric division of the genus Hypecoum (Papaveraceae). Nordic J. Bot. 10: 129–140.

CCDB · book-ipcn67-71 — MESICEK, J., & J. SOJAK. 1969. Chromosome counts of some Mongolian plants. Folia Geobot. Phytotax., Praha 4: 55-86.

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type565 records

Wild obs. + sensor252

Museum / vouchered313

Origin

Introduced3

Range

Area of Occupancy AOO1 324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 112≤1 km 38≤10 km 15>10 km 26

191 georeferenced · 61 without coordinates

Open the mapobservation + sensor252

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 1≤1 km 9≤10 km 12>10 km 4

26 georeferenced · 287 without coordinates

Open the institutions mapphysical evidence313

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	74
SXTCMlocation not on record	47
Moscow State Universitylocation not on record	40
Yangling, CN	29
WNNUlocation not on record	16
Institute of Applied Ecology, Academia Sinicalocation not on record	11
Inner Mongolia Universitylocation not on record	11
Jiangxi College of Educationlocation not on record	9
Xining, CN	6
Nanjing, CN	5
Beijing Normal Universitylocation not on record	4
Xian, CN	4
Shanxi Universitylocation not on record	4
Urumqi, CN	4
Shanghai, CN	3
Port Elizabeth Museum (Bayworld)location not on record	3
Tianjin Natural History Museumlocation not on record	3
xjulocation not on record	3
Awka, NG	2
Kunming, CN	2
Lanzhou, CN	2
Shanxi Institute of Biologylocation not on record	2
Xian, CN	2
Guangzhou, CN	2
Peking Universitylocation not on record	2
Beijing, CN	2
Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record	2
Taiyuan Normal Universitylocation not on record	2
Guangzhou, CN	2
Uppsala, SE	2
Guilin, CN	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Minia, EG	1
Zhengzhou, CN	1
Uniwersytet Śląski w Katowicachlocation not on record	1
Shanghai Chenshan Botanical Gardenlocation not on record	1
Siouxland Heritage Museumlocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1

38 institutions · 308 of 313 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Hypecoum erectum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 17.2–19.7

Seasonal swing summer↔winter37.6 °C

Max temp (day)24.3 °C 22.9–25.7

Min temp (night)10.3 °C 9.00–11.6

Precipitation16.4 mm/mo 14.1–18.7

Air humidity40.0 % 38.5–41.6

Moisture balance-142 mm/mo -152–-133

Vapour deficit1,280 Pa 1,208–1,352

Wind speed3.90 m/s 3.10–4.70

Cloud cover34.5 % 30.5–38.5

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)