Hyoscyamus niger
speciesAt a glance
Occurrence records40 503
Data sources16
Biological traits59
DNA specimens45
eDNA detections26
Sources16 archives
Databases and archives Hyoscyamus niger's data was compiled from.
WikipediaWikimedia Foundation16 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility40 503 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics45 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources59 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS184 compounds
Occurrence & distributionGBIF40 503 records
Environmental DNA1 datasets · 8 countries26 detections
DNA & barcodingBOLD · NCBI45 specimens
Genome at a glanceCCDB · GoaT1.4 Gbp
01Narrative
Hyoscyamus niger, commonly known as henbane, black henbane, or stinking nightshade, is a plant that is poisonous in large quantities, in the nightshade family Solanaceae. It is native to temperate Europe and Siberia, and naturalised in Great Britain and Ireland.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology22
Fruit length15 mm
Fruit length max15 mm
Fruit length min15 mm
Fruit width12 mm
Fruit width max12 mm
Fruit width min12 mm
Leaf length130 mm
⚠ sources differ — AusTraits: 130 mm · GIFT: 170 mm
Leaf length max300 mm
Leaf length min40 mm
Leaf mass78.78 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 2 702 mm² · GIFT: 2 702 mm²
Leaf width80 mm
⚠ sources differ — AusTraits: 80 mm · GIFT: 40 mm
Leaf width max60 mm
Leaf width min20 mm
Plant height0.678 m
⚠ sources differ — GIFT: 0.678 m · AusTraits: 0.5 m · LEDA: 0.6 m · TRY: 0.56 m
Plant height generative0.575 m
Plant height max1.15 m
Plant height min0.14 m
Seed length1.39 mm
⚠ sources differ — TRY: 1.39 mm · AusTraits: 1.5 mm
Seed mass0.642 mg
⚠ sources differ — TRY: 0.642 mg · LEDA: 0.853 mg · GIFT: 0.624 mg
Seed mass max0.792 mg
Seed mass min0.42 mg
Life cycle & reproduction16
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endOct
Flowering startJun
Flowering timeyynnnnnnnnny
Life formannual or biennial
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual biennial · LEDA: annuals · GIFT: biennial
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number8 000
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 300 m
Elevation min500 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTcrop fields, inhabited places, old fields, roadsides, ruderal sites
Leaf compoundnesssimple
Leaf shapeovate triangular
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)115 mg/g
⚠ sources differ — TRY: 115 mg/g · LEDA: 121 mg/g
Leaf n54 mg/g
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)32.66 mm²/mg
⚠ sources differ — TRY: 32.66 mm²/mg · LEDA: 36.55 mm²/mg · GIFT: 42.53 mm²/mg
Other traits2
Diaspore typeseed
Monocarpymonocarp
03Chemical composition184 compounds
Compounds documented for Hyoscyamus niger across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
💊 Medicinal use documented
Compound class profile5 classes
Tropane alkaloids36
Coumarinolignans13
Cinnamic acid amides9
Triacylglycerols6
Monoacylglycerols6
Documented compounds184 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| FAT | 389,000 ppm | DukesPhytochem | |
| LINOLEIC-ACID | 219,396 ppm | DukesPhytochem | |
| PROTEIN | 212,000 ppm | DukesPhytochem | |
| OLEIC-ACID | 136,928 ppm | DukesPhytochem | |
| GUM | 62,000 ppm | DukesPhytochem | |
| PALMITIC-ACID | 25,285 ppm | DukesPhytochem | |
| CALCIUM | 7,420 ppm | DukesPhytochem | |
| STEARIC-ACID | 6,224 ppm | DukesPhytochem | |
| POTASSIUM | 5,680 ppm | DukesPhytochem | |
| MAGNESIUM | 5,250 ppm | DukesPhytochem |
05DNA & barcoding45 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hyoscyamus niger has left across the world's sequence archives.
At a glance
DNA specimens45
Marker genes7
GenBank sequences10
eDNA detections26
Countries9
The DNA barcodea real sequence read deposited for this species
ACGCATCGCGTCGCCCCTCCTCGCCCGCGGGCGAACGAGGGGCGGATACTGGCCTCCCGTGCGCCCCCGCGCGCGCGGCCGGCCTAAATG …
Hyoscyamus niger voucher ZX-7462 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK5★rbcL3★rbcLa★ITS2★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Hyoscyamus niger carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 418 100 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Hyoscyamus niger1.42 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 34 n = 17
Ploidy2× diploid · measured
Chromosome records34–362n range34median34mode65records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3464×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +14
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Králik E. & Kothajová H., 2000: Karyologické štúdium slovenskej flóry XXXIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 37-41.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt
CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)
CCDB · iber-fl — Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Luque, T. & Z. Daz Lifante.Bocconea1: 303-364(1991).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3352
CCDB · fl-europaea — Griesinger 1937
CCDB · poland — Skali?ska M., Ma?ecka J., Izmai?ow R. et al. 1974. Further studies in chromosome numbers of Polish Angiosperms. Tenth contribution. Acta Biol. Cracov. Ser. Bot. 17, 133-163.
CCDB · ipcn-api-dl — Ma, X. H., R. L. Qin & W. B. Xing. 1985. Chromosome observation of twenty species of drug plants in Xingjiang. Acta Bot. Boreal.-Occid. Sin. 5: 149–154.
CCDB · ipcn-api-dl — Laane, M. M. & T. Lie. 1985. Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7–15.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Srivastava, S. & U. C. Lavania. 1987. Karyomorphology and DNA amount in relation to chiasma formation in Hyoscyamus L. Nucleus (Calcutta) 30: 94–98.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1990. Chromosome numbers in some representatives of the families Asclepiadaceae, Asteraceae, Boraginaceae, Chenopodiaceae, Lamiaceae, Oleaceae, Onagraceae, Scrophulariaceae, Solanaceae, Urticaceae from the Soviet Far East. Bot. Žhurn. (Moscow & Leningrad) 75: 1619–1622.
CCDB · ipcn-api-dl — Luque, T. & Z. D. Lifante. 1991. Chromosome numbers of plants collected during Iter Mediterraneum I in the SE of Spain. Bocconea 1: 303–364.
CCDB · ipcn-api-dl — Badr, A., S. F. Khalifa, A. I. Aboel-Atta & M. M. Abou-El-Enain. 1997. Chromosomal criteria and taxonomic relationships in the Solanaceae. Cytologia 62: 103–113.
CCDB · ipcn-api-dl — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal. 1997. Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365–368.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Sheidai, M., M. Mosallanejad & M. Khatamsaz. 1999. Karyological studies in Hyoscyamus species of Iran. Nordic J. Bot. 19(3): 369–373.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Tu, T. y. 2005. Cytological studies on the Sino-Himalayan endemic Anisodus and four related genera from the tribe Hyoscyameae (Solanaceae) and their systematic and evolutionary implications. Bot. J. Linn. Soc. 147: 457–468.
CCDB · ipcn-api-dl — Krasnikov, A. A. 1991. Chromosome numbers in some species of vascular plants from Novosibirsk region. Bot. Žhurn. (Moscow & Leningrad) 76: 476–479.
CCDB · book-ipcn67-71 — BAQUAR, S.R. 1967. Cytomorphological studies in the family Solanaceae from West Pakistan. Genetica 38: 388-397
CCDB · book-ipcn75-78 — Rostovtseva 1977
CCDB · book-ipcn75-78 — Magulaev 1976
CCDB · book-ipcn75-78 — Skalinska et al. 1974
CCDB · book-ipcn75-78 — Vasudevan 1975
CCDB · book-indian_vol1 — Vilmorin, R. de & Simonet, M. 1928; Tischler, G. 1934, 1937; Griesinger, R. 1937, Delay, C. 1947; Love, A. & Love, D. 1948; Vaarama, A. 1950; Gottschalk, W. 1954a; Mehra, P.N. & Sobti, S.N. 1954; Garajova, S. 1959; Baquar, S.R. 1967a ; Gill, L.S. 1972 ; Hammer, K. & Melchers, G. 1977
CCDB · book-fedorov — Vilmorin, Simonet 1928
CCDB · book-fedorov — Tischler 1934, 1!137
CCDB · book-fedorov — Griesinger 1937
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — LOve A., LOve D. 19-18
CCDB · book-fedorov — Vaarama 1950
CCDB · book-fedorov — Gottschalk 1954a
CCDB · book-fedorov — Mehra P. N., Sobti 1954
CCDB · book-fedorov — Garajova 1959
CCDB · book-fedorov — I. Slov. fl.
+22 more references
2n 361×CCDB · book-indian_vol1
CCDB · book-indian_vol1 — Mehra, P.N. 1945
n 1710×CCDB · solan · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +4
CCDB · solan
CCDB · ipcn-api-dl — Ghaffari, S. M. 1987. Chromosome counts of some angiosperms from Iran II. Iran. J. Bot. 3: 183–188.
CCDB · book-ipcn72 — GILL, L.S. 1972. Chromosome numbers in West-Himalayan bicarpellate species II. Bull. Torrey Bot. Club 99: 36-38.
CCDB · book-ipcn75-78 — Vasudevan 1975
CCDB · Cave1956supp — Gottschalk 1954a
CCDB · Cave1958 — Mehra & Sobti 1954
CCDB · CromoCat 2015 — Ghaffari, S. M. (1987b). Chromosome counts of some Angiosperms from Iran. II. Iranian J. Bot. 3: 184-188.
CCDB · CromoCat 2015 — Griesinger, R. (1937). Uber hypo und hyperdiploide formen von Petunia, Hyoscyamus, Lamium und einige andere chromosomenzählungen. Ber. Deutsch. Bot. Ges. 55: 556-571.
CCDB · CromoCat 2015 — Vasudevan, K. N. (1975b). Contribution to the cytotaxonomy and cytogeography of the flora of the western Himalayas (with an attempt to compare it with the flora of the Alpes). Part II. Ber. Schweiz. Bot. Ges. (Bull. Soc. Bot. Suisse) 85: 210-252.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Lubogoschinsky, P. I., Isaikina, M. M. & Fleckenstein, K. M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:891-892
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~0.7 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0.7 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type40 503 records
Wild obs. + sensor35 037
Museum / vouchered5 330
Cultivated / captive28
Fossil1
Other107
Origin
Native168
Introduced2 839
Range
Area of Occupancy AOO86 060 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy56% within 1 km
≤100 m 12 083≤1 km 3 546≤10 km 11 581>10 km 689
27 899 georeferenced · 7 138 without coordinates
Open the mapobservation + sensor35 037
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy49% within 1 km
≤100 m 381≤1 km 968≤10 km 1 214>10 km 218
2 781 georeferenced · 2 549 without coordinates
Open the institutions mapphysical evidence5 330
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 5>10 km 16
21 georeferenced · 7 without coordinates
Open the mapnot free-living28
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions135 of 266 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| LDlocation not on record | 281 |
| Olocation not on record | 263 |
| Moscow State Universitylocation not on record | 239 |
| Beijing, CN | 217 |
| South Kensington, GB | 199 |
| MeiseBGlocation not on record | 159 |
| Uniwersytet Wrocławskilocation not on record | 122 |
| Uppsala, SE | 114 |
| BRNUlocation not on record | 111 |
| Yangling, CN | 108 |
| Oskarshamn, SE | 104 |
| SLU Artdatabankenlocation not on record | 91 |
| Kuopio, FI | 90 |
| BIO-UNIPIlocation not on record | 73 |
| Tartu, EE | 72 |
| Oulu, FI | 72 |
| Turku, FI | 68 |
| Trondheim, NO | 67 |
| MAlocation not on record | 61 |
| Chengdu, CN | 61 |
| Xining, CN | 60 |
| Bergen, NO | 52 |
| Kunming, CN | 51 |
| Bronx, US | 46 |
| BFLlocation not on record | 45 |
| Adam Mickiewicz University in Poznańlocation not on record | 43 |
| KMNlocation not on record | 41 |
| TUR-Alocation not on record | 41 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 40 |
| Bern, CH | 40 |
| Salzburg, AT | 39 |
| Bozeman, US | 39 |
| Uniwersytet Warszawskilocation not on record | 38 |
| Tallinn, EE | 37 |
| València, ES | 37 |
| GJOlocation not on record | 31 |
| Museo Entomologico de Leonlocation not on record | 30 |
| Dresden, DE | 29 |
| Nanjing, CN | 28 |
| Barcelona, ES | 27 |
| Institute for Biology of National Academy of Sci.location not on record | 27 |
| Philadelphia, US | 27 |
| Mlocation not on record | 25 |
| Wlocation not on record | 25 |
| Helsinki, FI | 25 |
| Chengdu, CN | 25 |
| Servico de Microbiologia e Imunologialocation not on record | 24 |
| BDBClocation not on record | 24 |
| Logan, US | 23 |
| Entomological Society of Latvialocation not on record | 23 |
| Jyväskylä, FI | 23 |
| Moscow, US | 23 |
| Görlitz, DE | 22 |
| Zürich, CH | 21 |
| Québec, CA | 21 |
| Lanzhou, CN | 21 |
| Zürich, CH | 21 |
| Guangzhou, CN | 21 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 19 |
| WNNUlocation not on record | 18 |
| Missoula, US | 18 |
| Wuzhou, CN | 17 |
| Berlin, DE | 17 |
| GMBAlocation not on record | 17 |
| Pullman, US | 16 |
| BSBIlocation not on record | 15 |
| BClocation not on record | 15 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 14 |
| Inner Mongolia Universitylocation not on record | 14 |
| Pocatello, US | 14 |
| Spearfish, US | 13 |
| Corvallis, US | 13 |
| Université Lavallocation not on record | 13 |
| Brussel, BE | 13 |
| PRClocation not on record | 13 |
| Shanxi Institute of Biologylocation not on record | 12 |
| Philadelphia, US | 12 |
| WTUlocation not on record | 12 |
| Provo, US | 11 |
| Porvoo, FI | 10 |
| Xian, CN | 10 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 10 |
| Provincia di Livornolocation not on record | 10 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 9 |
| Natural History Museum Rotterdamlocation not on record | 9 |
| Frankfurt am Main | 9 |
| University of Alberta Museumslocation not on record | 9 |
| Ann Arbor, US | 9 |
| Chadron, US | 9 |
| Salamanca, ES | 9 |
| Nijmegen, NL | 8 |
| Boise, US | 8 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| SXTCMlocation not on record | 8 |
| Madrid, ES | 8 |
| Wuhan, CN | 7 |
| Urumqi, CN | 7 |
| DBF-NHMDlocation not on record | 7 |
| TROMlocation not on record | 7 |
| Vitoria, ES | 7 |
| Montréal, CA | 7 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 7 |
| Paris, FR | 7 |
| Denver, US | 7 |
| University of New Hampshirelocation not on record | 6 |
| Porrentruy, CH | 6 |
| Granada, ES | 6 |
| Phyletisches Museum Jenalocation not on record | 6 |
| Pamplona, ES | 6 |
| Saint John, CA | 6 |
| Pamplona, ES | 5 |
| Vancouver, CA | 5 |
| Jiangxi College of Educationlocation not on record | 5 |
| Museum Wasmannlocation not on record | 5 |
| Christchurch, NZ | 5 |
| Stockholm, SE | 5 |
| Chongqing Museumlocation not on record | 5 |
| Bourges, FR | 5 |
| Forssa, FI | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 5 |
| Chengdu, CN | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| UGentlocation not on record | 4 |
| CJBGlocation not on record | 4 |
| Adelaide, AU | 4 |
| Seoul, KR | 4 |
| SZUlocation not on record | 4 |
| Albuquerque, US | 4 |
| Saint Louis, US | 4 |
| Henderson, US | 4 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 4 |
| ENTClocation not on record | 4 |
| Beijing, CN | 4 |
| University of Stellenboschlocation not on record | 4 |
| Awka, NG | 4 |
| Acadia Universitylocation not on record | 3 |
| Caldwell, US | 3 |
| Grand Junction, US | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Tilburg, NL | 3 |
| IDElocation not on record | 3 |
| Karlsruhe, DE | 3 |
| Strecker Museum, Baylor Universitylocation not on record | 3 |
| Zhengzhou, CN | 3 |
| Peking Universitylocation not on record | 3 |
| Guilin, CN | 3 |
| Shanghai, CN | 3 |
| SNSNMClocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| Cambridge, US | 3 |
| Elocation not on record | 3 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 3 |
| Rocky Mountain Biological Laboratorylocation not on record | 3 |
| Durango, US | 3 |
| ISAlocation not on record | 3 |
| Winterthur, CH | 2 |
| Universität Göttingenlocation not on record | 2 |
| Claremont, US | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Canberra, AU | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| Wellington, NZ | 2 |
| IATMlocation not on record | 2 |
| Kyoto Universitylocation not on record | 2 |
| RJBJCIlocation not on record | 2 |
| Auckland, NZ | 2 |
| Flagstaff, US | 2 |
| Sion, CH | 2 |
| NTNU University Museum, Department of Natural Historylocation not on record | 2 |
| Plocation not on record | 2 |
| Finnish Museum of Natural Historylocation not on record | 2 |
| Mount Annan, AU | 2 |
| Montréal, CA | 2 |
| LfUlocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Kandalaksha State Nature Reservelocation not on record | 2 |
| Tula State Universitylocation not on record | 2 |
| Frauenfeld, CH | 2 |
| Sevilla, ES | 2 |
| Bloomington, US | 2 |
| Shanxi Universitylocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| CJBNlocation not on record | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Madison, US | 2 |
| CICYTEXlocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Burlington, US | 2 |
| EMTCMlocation not on record | 2 |
| Badajoz, ES | 2 |
| Toronto, CA | 2 |
| Xinxiang, CN | 2 |
| No collectionlocation not on record | 2 |
| ASUlocation not on record | 2 |
| IMMUlocation not on record | 2 |
| EEZA-CSIClocation not on record | 2 |
| BG-NMNHSlocation not on record | 1 |
| Chicago, US | 1 |
| NMBU:MINAlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 1 |
| Nanjing, CN | 1 |
| Changsha, CN | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Córdoba, ES | 1 |
| JBCLMlocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Firenze, IT | 1 |
| University of South Dakotalocation not on record | 1 |
| Göteborg, SE | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| HUFDlocation not on record | 1 |
| Columbia, US | 1 |
| Millersville, US | 1 |
| JMSlocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| Lausanne, CH | 1 |
| Alicante, ES | 1 |
| Victoria, CA | 1 |
| UoB-IBlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Bend, US | 1 |
| Northridge, US | 1 |
| Sri Ramaswamy Memorial Universitylocation not on record | 1 |
| FLADlocation not on record | 1 |
| JBAlocation not on record | 1 |
| Davenport, US | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| Brookings, US | 1 |
| Xiamen, CN | 1 |
| Pittsburg, US | 1 |
| Universität Erlangen-Nürnberglocation not on record | 1 |
| ESP026location not on record | 1 |
| H-Dunkellocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Coimbra, PT | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| US | 1 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 1 |
| San Luis Obispo, US | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Dekalb, US | 1 |
| ESP149location not on record | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| Macomb, US | 1 |
| New Brunswick, US | 1 |
| Riverside, US | 1 |
| GZUlocation not on record | 1 |
| Gijón, ES | 1 |
| Rovaniemi, FI | 1 |
| Phoenix, US | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Kew, GB | 1 |
| Sant Julià de Lòria, AD | 1 |
| Edinburgh, GB | 1 |
| Podgorica, ME | 1 |
266 institutions · 4 678 of 5 330 vouchered records shown · 627 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA26 detections
Where the DNA of Hyoscyamus niger was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found26
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 26 detections have coordinates
Open the map8 countries0
on sandy turf near seaside
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.2 °C 4.30–22.3
Seasonal swing summer↔winter17.1 °C
Max temp (day)14.5 °C 6.60–28.8
Min temp (night)9.00 °C 2.00–16.9
Precipitation72.5 mm/mo 35.5–113
Air humidity60.7 % 49.8–64.8
Moisture balance-17.8 mm/mo
Vapour deficit585 Pa 271–1,415
Wind speed4.10 m/s
Cloud cover48.0 % 31.8–56.0
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.