Hyoscyamus aureus

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Solanales/Solanaceae/Hyoscyamus

At a glance

Occurrence records1 648

Data sources8

Biological traits12

DNA specimens7

eDNA detections3

Sources8 archives

Databases and archives Hyoscyamus aureus's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 648 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~1.05 Gbp↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF1 648 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceGoaT1 Gbp

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.152 mg

Seed mass max0.2 mg

Seed mass min0.1 mg

Life cycle & reproduction3

Life formbiennial or perennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Aquaticterrestrial

Climatesubtropical

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hyoscyamus aureus has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes6

GenBank sequences5

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOL536521.1 ↗339 bpUSA · 2018

ACGT

TGCAGAATCCCGTGAACCATGGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Hyoscyamus aureus voucher MO:Carlsen3178 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK2★rbcL2★ITS1★ITS2trnH-psbA

animal barcodeplant barcodefungal barcodemarker

06Genome at a glanceGoaT

The complete instruction manual Hyoscyamus aureus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 046 460 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Hyoscyamus aureus1.05 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type1 648 records

Wild obs. + sensor1 586

Museum / vouchered52

Cultivated / captive1

Other9

Origin

Introduced3

Range

Area of Occupancy AOO2 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 438≤1 km 109≤10 km 137>10 km 12

696 georeferenced · 890 without coordinates

Open the mapobservation + sensor1 586

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 2

6 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence52

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Rishon Le Zion, IL	10
LDlocation not on record	7
Wlocation not on record	5
South Kensington, GB	4
Kew, GB	3
University of Stellenboschlocation not on record	3
Paris, FR	2
Dresden, DE	2
Saint Louis, US	2
MAlocation not on record	1
Oskarshamn, SE	1
GJOlocation not on record	1
Görlitz, DE	1
Berlin, DE	1
Universität Göttingenlocation not on record	1
València, ES	1
Frankfurt am Main	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

19 institutions · 48 of 52 vouchered records shown · 4 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Hyoscyamus aureus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 13.6–13.6

Seasonal swing summer↔winter26.3 °C

Max temp (day)19.5 °C

Min temp (night)8.70 °C

Precipitation114 mm/mo

Air humidity54.5 %

Moisture balance0.9 mm/mo

Vapour deficit709 Pa

Wind speed4.00 m/s

Cloud cover44.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hyoscyamus aureus

At a glance

Sources8 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment4

Physiology & chemistry1

At a glance

Genome sizehow big the whole instruction manual is

Record type1 648 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 19 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 648 records