Hymenoxys lemmonii

(Greene) Cockerell · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Hymenoxys

At a glance

Occurrence records131

Data sources13

Biological traits8

DNA specimens3

eDNA detections3

Sources13 archives

Databases and archives Hymenoxys lemmonii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility131 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Chemical compositionLOTUS · NPASS22 compounds

Occurrence & distributionGBIF131 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 30

01Narrative

Hymenoxys lemmonii is a species of flowering plant in the daisy family known by the common names Lemmon's rubberweed, Lemmon's bitterweed, and alkali hymenoxys. It is native to the western United States in and around the Great Basin in Utah, Nevada, northern California, and southeastern Oregon.Biota of North America Program 2014 county distribution map Hymenoxys lemmonii is a biennial or perennial herb with one or more branching stems growing erect to a maximum height near 50 centimeters (20 inches). It produces straight, dark green leaves up to 9 centimeters (3.6 inches) long and divided into a number of narrow, pointed lobes. The foliage and stem may be hairless to quite woolly. The daisy-like flower head is generally at least 1.5 centimeters (0.6 inches) wide, with a center of 50–125 thick golden disc florets and a shaggy fringe of 9–12 golden ray florets.Flora of North America, Hymenoxys lemmonii (Greene) Cockerell, 1904. Lemmon’s rubberweed or bitterweed The species is named for John Gill Lemmon, husband of prominent American botanist Sarah Plummer Lemmon.Greene, Edward Lee. 1898. Pittonia 3(18A): 272

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Life cycle & reproduction2

Life spanbiennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition22 compounds

Compounds documented for Hymenoxys lemmonii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Guaiane sesquiterpenoids10

Pseudoguaiane sesquiterpenoids8

Anthraquinones and anthrones4

Documented compounds22 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,3aR,5aS,8R,8aR,9aR)-1,8-dimethyl-5-methylidene-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5a,6,7,8a,9,9a-octahydro-1H-azuleno[6,5-b]furan-2-one	present	LOTUS
(1S,3R,7R,9R,10S)-1,9-dimethyl-4-methylidene-6,13-dioxatricyclo[8.4.0.03,7]tetradecane-5,14-dione	present	LOTUS
(3aR,4aS,5R,7R,8aS,9R,10aR)-Decahydro-5,7-dihydroxy-4a,9-dimethyl-3-methylenefuro(2',3':5,6)cyclohepta(1,2-c)pyran-2(3H)-one	present	LOTUS
(3aR,5R,5aS,7S,8R,8aS,9aR)-7,8-dihydroxy-5,8a-dimethyl-1-methylidene-4,5,5a,6,7,8,9,9a-octahydro-3aH-azuleno[6,5-b]furan-2-one	present	LOTUS
5,7-Dihydroxy-4a,9-dimethyl-3-methylidenedecahydrofuro[2',3':5,6]cyclohepta[1,2-c]pyran-2(3h)-one	present	LOTUS
[(1R,2R,4S,5R,6R,8R,11R,12S)-2-hydroxy-11-(hydroxymethyl)-2,6-dimethyl-10-oxo-9,14-dioxatetracyclo[9.2.1.01,5.08,12]tetradecan-4-yl] (E)-2-methylbut-2-enoate	present	LOTUS
[(1S,3aR,5R,5aS,6S,8S,8aS,9aS)-1,8-dihydroxy-1-(hydroxymethyl)-5,8a-dimethyl-2-oxo-4,5,5a,6,7,8,9,9a-octahydro-3aH-azuleno[6,5-b]furan-6-yl] (E)-2-methylbut-2-enoate	present	LOTUS
[(1S,3R,7S,9R,10S,11R,14S)-11-[(2R,3R,4S,5S,6R)-6-(acetyloxymethyl)-3,4,5-trihydroxyoxan-2-yl]oxy-1,9-dimethyl-4-methylidene-5-oxo-6,13-dioxatricyclo[8.4.0.03,7]tetradecan-14-yl] (2R)-2-methylbutanoate	present	LOTUS
[(1S,3R,7S,9R,10S,11R,14S)-11-hydroxy-1,9-dimethyl-4-methylidene-5-oxo-6,13-dioxatricyclo[8.4.0.03,7]tetradecan-14-yl] (2S)-2-methylbutanoate	present	LOTUS
[(2R,3S,4S,5R,6S)-6-[[(1S,3aR,5aS,8R,8aR,9aR)-1,8-dimethyl-5-methylidene-2-oxo-3a,4,5a,6,7,8a,9,9a-octahydro-1H-azuleno[6,7-b]furan-8-yl]oxy]-3,4,5-trihydroxyoxan-2-yl]methyl acetate	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenoxys lemmonii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAF229280.1 ↗641 bp

ACGT

TCGAACCCTGCTTGGCAGAACAACCCGTGAACAAGTAATAACAACATGGATTCTCGGGCATCAGGCTTTTGGCTTGACGCTCGTGAAGCC …

Hymenoxys lemmonii internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hymenoxys lemmonii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 301×CCDB · eflora

CCDB · eflora

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type131 records

Wild obs. + sensor3

Museum / vouchered128

Range

Area of Occupancy AOO312 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 12≤1 km 14≤10 km 22>10 km 1

49 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence128

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	20
Riverside, US	10
Logan, US	9
Claremont, US	8
Provo, US	8
Henderson, US	6
Bureau of Land Managementlocation not on record	6
Eastern Nevada Landscape Coalitionlocation not on record	6
University of Stellenboschlocation not on record	5
Davis, US	4
Canadian Department of Agriculturelocation not on record	4
Moscow, US	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Angwin, US	2
San Jose, US	2
Albuquerque, US	2
Flagstaff, US	2
Bloomington, US	2
Columbia, US	2
San Diego, US	2
Arcata, US	1
Wuzhou, CN	1
San Luis Obispo, US	1
Fort Worth, US	1
Mississippi State, US	1
Boise, US	1
KNFYlocation not on record	1
Santa Barbara, US	1
EL PASO, US	1
Chongqing Museumlocation not on record	1
CASlocation not on record	1
Corvallis, US	1
Phoenix, US	1
US	1

34 institutions · 118 of 128 vouchered records shown · 10 without an institution code

09Environmental DNA3 detections

Where the DNA of Hymenoxys lemmonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)