Hymenothrix wrightii

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Hymenothrix

At a glance

Occurrence records680

Data sources10

Biological traits9

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Hymenothrix wrightii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility680 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Occurrence & distributionGBIF680 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Hymenothrix wrightii (Wright's hymenothrix or Wright's thimblehead) is a North American species of flowering plant in the daisy family. It grows in northwestern Mexico (Sonora, Chihuahua, Baja California) and the southwestern United States (western Texas, Arizona, New Mexico, far southern California).Biota of North America Program 2014 county distribution mapSEINet, Southwestern Biodiversity, Arizona chapter Hymenothrix wrightii is a perennial herb up to 60 cm (2 feet) tall. One plant produces 6-8 flower heads per stem, in a flat-topped array. Each head has 15-30 white, pink, or pale purple disc flowers but no ray flowers. The individual disc flowers are larger and showier than in many other species in the family.Gray, Asa. 1853. Smithsonian Contributions to Knowledge 5(6): 97–98Rydberg, Per Axel. 1914. North American Flora 34(1): 56 Trichymenia wrightiiFlora of North America, Hymenothrix wrightii A. Gray, 1853.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Size & morphology1

Seed mass1.91 mg

Life cycle & reproduction2

Life spanbiennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenothrix wrightii has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP972316.1 ↗648 bpUSA

ACGT

TCGAATCCTGCATGGCACAACGACCAGCGAACATGTACCAACATCTTGGCTTGGCGGGGACCGATGCATTTGTTTCGGACCTTGTGAAGC …

Hymenothrix wrightii voucher Hammond 10576 TEX/LL internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hymenothrix wrightii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 243×CCDB · eflora · CCDB · book-fedorov

CCDB · eflora

CCDB · book-fedorov — Turner 1962

CCDB · book-fedorov — Turner, Flyr 1966

n 124×CCDB · ipcn-api-dl · CCDB · Cave1962

CCDB · ipcn-api-dl — Ward, D. E. 1983. Chromosome counts from New Mexico and southern Colorado. Phytologia 54: 302–309.

CCDB · ipcn-api-dl — Salter, S. & D. J. PINKAVA. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 273–274.

CCDB · ipcn-api-dl — Keil, D. J. & D. J. Pinkava. 1976. Chromosome counts and taxonomic notes for Compositae from the United States and Mexico. Amer. J. Bot. 63: 1393–1403.

CCDB · Cave1962 — Turner 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type680 records

Wild obs. + sensor297

Museum / vouchered381

Other2

Origin

Native1

Range

Area of Occupancy AOO1 616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 155≤1 km 21≤10 km 5>10 km 8

189 georeferenced · 108 without coordinates

Open the mapobservation + sensor297

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 40≤1 km 46≤10 km 37>10 km 6

129 georeferenced · 252 without coordinates

Open the institutions mapphysical evidence381

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions29 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	104
Flagstaff, US	51
Phoenix, US	38
San Diego, US	36
Austin, US	18
Bronx, US	18
EL PASO, US	16
Riverside, US	16
Claremont, US	12
Albuquerque, US	11
San Luis Obispo, US	8
Mexico City, MX	5
Austin, US	4
Wuzhou, CN	4
CASlocation not on record	4
Hermosillo, MX	3
USFSlocation not on record	3
Saint Louis, US	2
DOI/NPS, Greenbelt Parklocation not on record	2
DOI/NPS, Colonial National Historical Parklocation not on record	2
Feira de Santana, BR	1
Provo, US	1
San Diego Natural History Museum, Herbariumlocation not on record	1
University of Stellenboschlocation not on record	1
Miami, US	1
Laboratorio de Ictiologialocation not on record	1
Montréal, CA	1
Kew, GB	1
Chongqing Museumlocation not on record	1
Davis, US	1
Frankfurt am Main	1
Pullman, US	1
Logan, US	1
Santa Barbara, US	1
University of Alberta Museumslocation not on record	1
Henderson, US	1
The University of Arizonalocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1
Lubbock, US	1
Bloomington, US	1
Angwin, US	1
McWane Science Centerlocation not on record	1

42 institutions · 379 of 381 vouchered records shown · 2 without an institution code

09Environmental DNA2 detections

Where the DNA of Hymenothrix wrightii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

Ecotone of pine-oak woodland & upland grasse…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.1 °C 14.1–14.1

Seasonal swing summer↔winter16.0 °C

Max temp (day)21.0 °C

Min temp (night)8.40 °C

Precipitation26.5 mm/mo

Air humidity43.0 %

Moisture balance-80.5 mm/mo

Vapour deficit924 Pa

Wind speed2.50 m/s

Cloud cover21.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)