Hymenothrix wislizeni

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Hymenothrix

At a glance

Occurrence records533

Data sources13

Biological traits10

DNA specimens1

eDNA detections1

Sources13 archives

Databases and archives Hymenothrix wislizeni's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility533 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS · NPASS11 compounds

Occurrence & distributionGBIF533 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Hymenothrix wislizeni, the Trans-Pecos thimblehead, is a North American species of flowering plant in the daisy family. It grows in northwestern Mexico (Baja California, Sonora, Chihuahua) and the southwestern United States (far western Texas, Arizona, New Mexico).Biota of North America Program 2014 county distribution mapSEINet, Southwestern Biodiversity, Arizona chapter Hymenothrix wislizeni is an annual herb up to 70 cm tall. Each head has 15-30 yellow or cream-colored disc flowers surrounded by 8-12 yellow ray flowers.Flora of North America, Hymenothrix wislizeni A. Gray, 1849.Gray, Asa. 1849. Memoirs of the American Academy of Arts and Science, new series 4(1): 102

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition11 compounds

Compounds documented for Hymenothrix wislizeni across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Aporphine alkaloids3

Germacrane sesquiterpenoids2

Aromadendrane sesquiterpenoids2

Aporphine alkaloids $ Isoquinoline alkaloids2

Caryophyllane sesquiterpenoids1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Dicentrine	present	NPASS
(-)-Caryophyllene	present	LOTUS
(12S)-15,16,17-trimethoxy-11-methyl-3,5-dioxa-11-azapentacyclo[10.7.1.02,6.08,20.014,19]icosa-1(20),2(6),7,14,16,18-hexaene	present	NPASS
(1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol	present	LOTUS
(3aR,4R,6aR,7S,9aR,9bS)-4,7-dihydroxy-9-methyl-3,6-dimethylidene-4,5,6a,7,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-2-one	present	LOTUS
(S,1Z,6Z)-8-Isopropyl-1-methyl-5-methylenecyclodeca-1,6-diene	present	LOTUS
Dehydrodicentrine	present	NPASS
Dicentrinone	present	NPASS
Germacrene D	present	LOTUS
Ocopodine, Dehydro derivative of	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenothrix wislizeni has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKX260992.1 ↗649 bpUSA

ACGT

TCGAATCCTGCATAGCACAACGACCAGCGAACATGTACCAACATCTTGGCTTTATGGGGACCGATGCTTTCGTTTCGGGCCTTGTGAAGC …

Hymenothrix wislizeni internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hymenothrix wislizeni carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · ipcn-api-dl · CCDB · book-fedorov

CCDB · ipcn-api-dl — Zhao, Z. & B. L. Turner. 1993. Documented chromosome numbers 1993: 3. Miscellaneous U.S.A. and Mexican species, mostly Asteraceae. Sida 15: 649–653.

CCDB · book-fedorov — Turner 1962

n 126×CCDB · ipcn-api-dl · CCDB · book-ipcn66 · CCDB · book-ipcn72 +1

CCDB · ipcn-api-dl — Powell, A. M. & S. A. Powell. 1978. Chromosome Numbers in Asteraceae. Madroño 25(3): 160–169.

CCDB · ipcn-api-dl — Salter, S. & D. J. PINKAVA. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 273–274.

CCDB · ipcn-api-dl — Keil, D. J. & D. J. Pinkava. 1976. Chromosome counts and taxonomic notes for Compositae from the United States and Mexico. Amer. J. Bot. 63: 1393–1403.

CCDB · book-ipcn66 — Turner & Flyr 1966

CCDB · book-ipcn72 — PINKAVA, D.J., R.C. BROWN, & M.G. MCLEOD. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.

CCDB · Cave1962 — Turner 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type533 records

Wild obs. + sensor160

Museum / vouchered358

Other15

Range

Area of Occupancy AOO1 616 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 95≤1 km 17≤10 km 6>10 km 6

124 georeferenced · 36 without coordinates

Open the mapobservation + sensor160

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 64≤1 km 34≤10 km 14>10 km 10

122 georeferenced · 236 without coordinates

Open the institutions mapphysical evidence358

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	120
Riverside, US	35
Phoenix, US	31
Austin, US	28
Bronx, US	24
EL PASO, US	22
Albuquerque, US	18
Mexico City, MX	14
Flagstaff, US	9
San Diego, US	9
San Luis Obispo, US	7
Austin, US	6
Hermosillo, MX	5
Saint Louis, US	3
Wuzhou, CN	3
University of Stellenboschlocation not on record	3
Irvine, US	2
USFSlocation not on record	2
Fort Worth, US	2
Pullman, US	1
Moscow, US	1
Provo, US	1
Arizona State University Biocollectionslocation not on record	1
CASlocation not on record	1
The University of Arizonalocation not on record	1
Instituto de Ecología, Universidad Nacional Autónoma de Méxicolocation not on record	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
La Paz, MX	1
Severin-McDaniel Insect Collectionlocation not on record	1
Angwin, US	1
Santa Barbara, US	1

32 institutions · 356 of 358 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Hymenothrix wislizeni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)