Hymenostegia bakeriana — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Hymenostegia

At a glance

Occurrence records29

Data sources8

Biological traits6

DNA specimens7

eDNA detections3

Sources8 archives

Databases and archives Hymenostegia bakeriana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility29 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources6 traits

Occurrence & distributionGBIF29 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Hymenostegia bakeriana is a species of plant in the family Fabaceae. It is found in Cameroon and Nigeria. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment4

Climatewet tropical

Climberself-supporting

Growth formtree

Woodinesswoody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenostegia bakeriana has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLKC628520.1 ↗706 bpCameroon · 2008

ACGT

AGCAAGTGTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATGAAACCAAGGATACTGATATCTTGGC …

Hymenostegia bakeriana voucher PM5402 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL3rbcLatrnH-psbA

plant barcodemarker

08Occurrence & distribution

Record type29 records

Museum / vouchered29

Range

Area of Occupancy AOO44 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 29 records without

Open the institutions mapphysical evidence29

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	4
Yaoundé, CM	3
Universite Libre de Bruxelleslocation not on record	3
Bronx, US	2
University of Stellenboschlocation not on record	2
Berlin, DE	1
Pretoria, ZA	1
Saint Louis, US	1

8 institutions · 17 of 29 vouchered records shown · 12 without an institution code

09Environmental DNA3 detections

Where the DNA of Hymenostegia bakeriana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.8 °C 24.3–24.8

Seasonal swing summer↔winter2.80 °C

Max temp (day)28.8 °C 27.9–28.8

Min temp (night)21.9 °C 21.8–21.9

Precipitation156 mm/mo 156–355

Air humidity72.5 % 72.5–74.2

Moisture balance43.4 mm/mo 43.4–246

Vapour deficit859 Pa 782–859

Wind speed1.00 m/s 0.9–1.00

Cloud cover22.6 % 22.6–31.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.