Hymenophyton flabellatum

(Labill.) Dumort. ex Trevis. · species

image placeholder — illustration coming later

Plantae/Marchantiophyta/Jungermanniopsida/Pallaviciniales/Hymenophytaceae/Hymenophyton

At a glance

Occurrence records1 366

Data sources9

Biological traits0

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Hymenophyton flabellatum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 366 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS14 compounds

Occurrence & distributionGBIF1 366 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Hymenophyton flabellatum is a species of the order Pallaviciniales (liverworts), one of perhaps several species in the genus Hymenophyton. It is a dendroid thalloid liverwort belongs to the family Hymenophytaceae and is commonly known as Fan liverwort. It is found in New Zealand, Chile, and common in wet forests of Australia and Tasmania. Hymenophyton flabellatum closely resembles with small filmy fern, Hymenophyllum and can be confused with the liverwort, Symphyogyna hymenophyllum. Growling Swallett

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition14 compounds

Compounds documented for Hymenophyton flabellatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Acyl phloroglucinols9

Chromones3

Fatty aldehydes1

Caryophyllane sesquiterpenoids1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Caryophyllene	present	LOTUS
(2R)-2,5-dihydroxy-7-methoxy-2-methyl-3H-chromen-4-one	present	LOTUS
(3R)-3-hydroxy-1-(2-hydroxy-4,6-dimethoxyphenyl)butan-1-one	present	LOTUS
(E)-1-(2,4-dihydroxy-6-methoxyphenyl)but-2-en-1-one	present	LOTUS
(Z)-1-(2,4,6-trimethoxyphenyl)but-2-en-1-one	present	LOTUS
1-(2,4,6-Trimethoxyphenyl)but-2-en-1-one	present	LOTUS
1-(2,4-Dihydroxy-6-methoxyphenyl)but-2-en-1-one	present	LOTUS
1-(2-Hydroxy-4,6-dimethoxyphenyl)-1,3-butanedione	present	LOTUS
1-(2-Hydroxy-4,6-dimethoxyphenyl)but-2-en-1-one	present	LOTUS
2-Buten-1-one, 1-(2,4,6-trimethoxyphenyl)-, (E)-	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenophyton flabellatum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY640217.1 ↗372 bp

ACGT

TAGTGTGAATTGCAGAATTCCGTGAATCATCGAGTTTTTGAACGCATGTTGCGCCCGAGGCTTGTCCCGAGGGCATGTCTGCCTGAGCGT …

Hymenophyton flabellatum isolate HF5 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type1 366 records

Wild obs. + sensor999

Museum / vouchered367

Origin

Native37

Range

Area of Occupancy AOO2 688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 486≤1 km 136≤10 km 53>10 km 14

689 georeferenced · 310 without coordinates

Open the mapobservation + sensor999

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 20≤1 km 71≤10 km 73>10 km 12

176 georeferenced · 191 without coordinates

Open the institutions mapphysical evidence367

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Entomologico de Leonlocation not on record	83
Christchurch, NZ	60
Wellington, NZ	51
Canberra, AU	45
Auckland, NZ	41
Mount Annan, AU	35
Hobart, AU	14
Brisbane, AU	9
QVMAGlocation not on record	9
Rotorua, NZ	5
AADClocation not on record	5
Armidale, AU	2
Saint Louis, US	2
NSW Dept of Planning, Industry and Environmentlocation not on record	1
Parkville, AU	1
John T. Waterhouse Herbariumlocation not on record	1
Frankfurt am Main	1
South Kensington, GB	1

18 institutions · 366 of 367 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Hymenophyton flabellatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.7 °C 11.7–11.7

Seasonal swing summer↔winter12.3 °C

Max temp (day)16.2 °C

Min temp (night)7.10 °C

Precipitation131 mm/mo

Air humidity61.7 %

Moisture balance5.30 mm/mo

Vapour deficit525 Pa

Wind speed6.40 m/s

Cloud cover38.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hymenophyton flabellatum

At a glance

Sources9 archives

Compound class profile4 classes

Documented compounds14 total

At a glance

Record type1 366 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 366 records