Hymenophyllum falklandicum

Baker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Hymenophyllales/Hymenophyllaceae/Hymenophyllum

At a glance

Occurrence records168

Data sources5

Biological traits13

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Hymenophyllum falklandicum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility168 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF168 records

DNA & barcodingNCBIsequences

01Narrative

Hymenophyllum falklandicum, the Falklands filmy fern, is a plant in the fern family Hymenophyllaceae. It is native to southern South America and some subantarctic islands.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTAusTraits

Size & morphology2

Leaf length20 mm

Leaf width6 mm

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max1 700 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · AusTraits: fern

Leaf shapeoblong

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenophyllum falklandicum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLOQ969927.1 ↗1 200 bpChile · 2009

ACGT

CCCGACTATGAGACCAAAGATACTGATATCTTGGCAGCCTTCCGAATGACTCCCCAACCTGGAGTACCGGCCGAGGAAGCTGGAGCTGCA …

Hymenophyllum falklandicum isolate CL1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4

plant barcode

08Occurrence & distribution

Record type168 records

Wild obs. + sensor28

Museum / vouchered140

Range

Area of Occupancy AOO504 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 9≤1 km 2≤10 km 1>10 km 1

13 georeferenced · 15 without coordinates

Open the mapobservation + sensor28

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy53% within 1 km

≤100 m 1≤1 km 8≤10 km 7>10 km 1

17 georeferenced · 123 without coordinates

Open the institutions mapphysical evidence140

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	33
AASlocation not on record	30
San Isidro, AR	25
South Kensington, GB	12
Museo Entomologico de Leonlocation not on record	6
Hobart, AU	5
Castelar, AR	4
BAlocation not on record	3
Fundación Miguel Lillolocation not on record	3
Herbario Universidad de Concepciónlocation not on record	2
Laboratory of Palaeontologylocation not on record	2
Saint Louis, US	2
Minia, EG	2
Canberra, AU	2
LDlocation not on record	2
Stockholm, SE	1
Buenos Aires, AR	1
Paris, FR	1
Olocation not on record	1
AADClocation not on record	1
Adelaide, AU	1
Corrientes, AR	1

22 institutions · 140 of 140 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)