Hymenophyllum bivalve

(G.Forst.) Sw. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Hymenophyllales/Hymenophyllaceae/Hymenophyllum

At a glance

Occurrence records1 094

Data sources7

Biological traits17

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Hymenophyllum bivalve's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 094 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources17 traits

Occurrence & distributionGBIF1 094 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Sphaerocionium bivalve là một loài dương xỉ trong họ Hymenophyllaceae. Loài này được C.Presl mô tả khoa học đầu tiên năm 1843. Danh pháp khoa học của loài này chưa được làm sáng tỏ.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsGIFTTRY

Size & morphology5

Leaf length140 mm

Leaf length max300 mm

Leaf width47.5 mm

Leaf width max200 mm

Leaf width min50 mm

Life cycle & reproduction2

Life formlithophyte or epiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formfern

Leaf compoundnesscompound

Leaf shapewidely_ovate

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenophyllum bivalve has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLAB496573.1 ↗2 664 bpNew Zealand

ACGT

TATACTCCCGACTATGAGACCAAAGATACTGATATCTTGGCAGCCTTCCGAATGACTCCCCAACCTGGAGTACCGGCGGAGGAAGCTGGA …

Hymenophyllum bivalve chloroplast rbcL, accD genes for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, beta subunit of acetyl-coenzyme A carboxylase, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Hymenophyllum bivalve carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Chromosome records22–442n range44median44mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 442×CCDB · book-LoveLove1977

CCDB · book-LoveLove1977 — Brownlie 1958

CCDB · book-LoveLove1977 — Vessey & Barlow 1963

2n 221×CCDB · Cave1963

CCDB · Cave1963 — Vessey & Barlow 1963

n 222×CCDB · Cave1958 · CCDB · Cave1963

CCDB · Cave1958 — Brownlie 1958

CCDB · Cave1963 — Vessey & Barlow 1963

08Occurrence & distribution

Record type1 094 records

Wild obs. + sensor644

Museum / vouchered448

Cultivated / captive1

Other1

Origin

Native21

Range

Area of Occupancy AOO2 960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 450≤1 km 78≤10 km 23>10 km 3

554 georeferenced · 90 without coordinates

Open the mapobservation + sensor644

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 18≤1 km 13≤10 km 44>10 km 12

87 georeferenced · 361 without coordinates

Open the institutions mapphysical evidence448

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	136
Wellington, NZ	136
Auckland, NZ	59
Mount Annan, AU	21
Rotorua, NZ	16
Brisbane, AU	15
Museo Entomologico de Leonlocation not on record	14
Canberra, AU	10
South Kensington, GB	7
Armidale, AU	6
LDlocation not on record	5
Hobart, AU	4
Wollongong, AU	3
Chapel Hill, US	3
HAWlocation not on record	2
Honolulu, US	2
Provincia di Livornolocation not on record	1
Dresden, DE	1
John T. Waterhouse Herbariumlocation not on record	1
University of Stellenboschlocation not on record	1
Parkville, AU	1
Brookings, US	1
Austin, US	1
Smithfield, AU	1

24 institutions · 447 of 448 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Hymenophyllum bivalve was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–5.70

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C

Min temp (night)1.40 °C

Precipitation130 mm/mo

Air humidity62.6 %

Moisture balance54.3 mm/mo

Vapour deficit357 Pa

Wind speed5.90 m/s

Cloud cover38.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hymenophyllum bivalve

At a glance

Sources7 archives

Size & morphology5

Life cycle & reproduction2

Diet & foraging1

Habitat & environment8

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 094 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 24 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 094 records