Hymenopappus tenuifolius

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Hymenopappus

At a glance

Occurrence records1 046

Data sources10

Biological traits8

DNA specimens4

eDNA detections2

Sources10 archives

Databases and archives Hymenopappus tenuifolius's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 046 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF1 046 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Hymenopappus tenuifolius là một loài thực vật có hoa trong họ Cúc. Loài này được Pursh mô tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction2

Life spanbiennial

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition4 compounds

Compounds documented for Hymenopappus tenuifolius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Lupane triterpenoids4

Documented compounds4 total

Compound	Amount	Source
(1R,3aR,5aR,5bR,7aR,9S,11aR,11bR,13aS,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-ol	present	LOTUS
[(1R,3aR,5aR,5bR,7aR,9S,11aR,11bR,13aS,13bR)-3a,5a,5b,8,8,11a-hexamethyl-1-prop-1-en-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b,12,13,13a,13b-hexadecahydrocyclopenta[a]chrysen-9-yl] acetate	present	LOTUS
Lupeol	present	LOTUS
Lupeol Acetate	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenopappus tenuifolius has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOL537401.1 ↗350 bpUSA · 2019

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGATGCCATCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Hymenopappus tenuifolius voucher BRIT:Gostel429 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1ITS2ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Hymenopappus tenuifolius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome records34–342n range34median34mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 343×CCDB · eflora · CCDB · book-fedorov · CCDB · Cave1956

CCDB · eflora

CCDB · book-fedorov — Turner 1956b

CCDB · Cave1956 — Turner a

n 171×CCDB · Cave1956

CCDB · Cave1956 — Turner a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 046 records

Wild obs. + sensor335

Museum / vouchered711

Range

Area of Occupancy AOO3 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 180≤1 km 25≤10 km 5>10 km 13

223 georeferenced · 112 without coordinates

Open the mapobservation + sensor335

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 24≤1 km 83≤10 km 292>10 km 96

495 georeferenced · 216 without coordinates

Open the institutions mapphysical evidence711

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions32 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	314
Fort Worth, US	73
Bronx, US	62
DOI/NPS, Colonial National Historical Parklocation not on record	30
Austin, US	29
Musee des Dinosaures d'Esperaza (Aude)location not on record	24
Lubbock, US	24
Chadron, US	23
Albuquerque, US	17
Lincoln, US	12
Pullman, US	11
DOI/NPS, Greenbelt Parklocation not on record	10
Emporia, US	9
University of Stellenboschlocation not on record	8
Denver, US	7
Bangkok, TH	5
Chongqing Museumlocation not on record	5
Davis, US	5
San Angelo, US	4
Stockholm, SE	4
Stephenville, US	4
Spearfish, US	3
Texas Lutheran Universitylocation not on record	3
Burlington, US	3
Phoenix, US	2
Tempe, US	2
Pocatello, US	2
Saint Louis, US	2
EL PASO, US	2
Cincinnati, US	1
Flagstaff, US	1
Northridge, US	1
Beijing, CN	1
Baltimore, US	1
Mississippi State, US	1
Denton, US	1
BAYLUlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Philadelphia, US	1
Madison, US	1

40 institutions · 710 of 711 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Hymenopappus tenuifolius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 22.9–22.9

Seasonal swing summer↔winter21.0 °C

Max temp (day)28.8 °C

Min temp (night)18.2 °C

Precipitation116 mm/mo

Air humidity57.0 %

Moisture balance-61.1 mm/mo

Vapour deficit1,201 Pa

Wind speed4.80 m/s

Cloud cover35.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources10 archives

Life cycle & reproduction2

Diet & foraging1

Habitat & environment5

Compound class profile1 class

Documented compounds4 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 046 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions32 of 40 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 046 records