Hymenonema laconicum — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Hymenonema

At a glance

Occurrence records16

Data sources5

Biological traits10

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Hymenonema laconicum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF16 records

DNA & barcodingNCBIsequences

01Narrative

Hymenonema laconicum is a species of herbaceous perennial plant in the Asteraceae family. It is small to average height, with a rosette of greyish pinnately segmented leaves, and little branching solid stems carrying one to three heads of orange or yolk yellow ray-flowers, with a purple anther tube, and scaly pappus. The species is an endemic of the central and south-eastern Peloponnesos, and flowers in May and June.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass4.22 mg

Seed mass max4.22 mg

Seed mass min4.22 mg

Life cycle & reproduction2

Life formperennial

Raunkiær life formhemicryptophyte

Habitat & environment4

Aquaticterrestrial

Climatesubtropical

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding8 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenonema laconicum has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences8

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH728950.1 ↗221 bpGreece

ACGT

ATCGCGTCGCTCCCCCACTTTCTCCTTAATGGATTGGTGGTATTGGGGGCGGATAATGGCCTCCCATTCCAGTGGTGTGGTTGGCCCAAA …

Hymenonema laconicum isolate A906 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS8

fungal barcode

08Occurrence & distribution

Record type16 records

Wild obs. + sensor4

Museum / vouchered12

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	3
LDlocation not on record	3
Wlocation not on record	3
MAlocation not on record	2
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

5 institutions · 12 of 12 vouchered records shown