Hymenogaster huthii

Stielow, Bratek & Hensel · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hymenogastraceae/Hymenogaster

At a glance

Occurrence records26

Data sources7

Biological traits0

DNA specimens1

eDNA detections643

Sources7 archives

Databases and archives Hymenogaster huthii's data was compiled from.

GBIFGlobal Biodiversity Information Facility26 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI643 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF26 records

Environmental DNA4 datasets · 14 countries643 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenogaster huthii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences9

eDNA detections643

Countries14

The DNA barcodea real sequence read deposited for this species

ITSMK838362.1 ↗306 bp

ACGT

AACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTTAATTCTCAACCTTTATTAGCTTTTGCTGATAATGG …

Hymenogaster huthii voucher OTU187s 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type26 records

Wild obs. + sensor1

Museum / vouchered25

Range

Area of Occupancy AOO52 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 25 records without

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Karlsruhe, DE	11

1 institutions · 11 of 25 vouchered records shown · 13 without an institution code

09Environmental DNA643 detections

Where the DNA of Hymenogaster huthii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found643

Studies independent surveys4

Countries14

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 643 detections have coordinates

Open the map14 countries0

PalearcticNearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 5.70–17.5

Seasonal swing summer↔winter21.8 °C

Max temp (day)16.8 °C 8.40–20.8

Min temp (night)10.2 °C 2.30–15.4

Precipitation65.3 mm/mo 56.6–106

Air humidity61.5 % 58.6–66.3

Moisture balance-18.7 mm/mo -65.5–52.6

Vapour deficit594 Pa 326–784

Wind speed3.30 m/s 2.60–4.70

Cloud cover41.8 % 34.8–59.5

CHELSA 1981–2010, ~9 km grid, at location & month of 620 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)