Hymenodictyon parvifolium

Oliv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Hymenodictyon

At a glance

Occurrence records57

Data sources8

Biological traits19

DNA specimens10

eDNA detections6

Sources8 archives

Databases and archives Hymenodictyon parvifolium's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF57 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI10 specimens

01Narrative

Hymenodictyon parvifolium Oliv. is a small rubiaceous African tree and is one of some 24 species in the genus, with a tropical African and Asian distribution. This species grows as a small tree to some 5 metres tall, or sometimes a liane or scrambler to 10.5 m, and is found in low-altitude woodland (250 – 1110 m).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height5 m

Plant height max5 m

Plant height min4 m

Seed mass7.71 mg

⚠ sources differ — TRY: 7.71 mg · GIFT: 4.83 mg

Seed mass max4.83 mg

Seed mass min4.83 mg

Life cycle & reproduction3

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max300 m

Epiphyteterrestrial

Growth formshrub

Habitat GIFTdry bush-, or woodland, usually in rocky sites

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenodictyon parvifolium has left across the world's sequence archives.

At a glance

DNA specimens10

Marker genes6

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKC737607.1 ↗562 bp

ACGT

GCCGGGGGGGGAGACTAAGCCCTCCCCTTCCTTTCCTTCCCGGCGCCCTCCGCGCGCTCGCCGCGCGGAGAACGTAACTCAACCCCGGCG …

Hymenodictyon parvifolium voucher Luke 8358 (UPS) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★matK2★rbcL5★rbcLa★ITS3★ITS2

animal barcodeplant barcodefungal barcode

08Occurrence & distribution

Record type57 records

Wild obs. + sensor14

Museum / vouchered43

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 4≤1 km 1>10 km 2

7 georeferenced · 7 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	14
Kew, GB	7
MeiseBGlocation not on record	3
Instituto de Investigação Científica Tropicallocation not on record	3
University of Johannesburg, Department of Botany and Plant Biotechnologylocation not on record	2
Uppsala, SE	2
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
Bronx, US	1
Stockholm, SE	1
Chongqing Museumlocation not on record	1
Buffelskloof Private Nature Reserve, Herbariumlocation not on record	1
University of Stellenboschlocation not on record	1
BPRHlocation not on record	1

13 institutions · 38 of 43 vouchered records shown · 4 without an institution code

09Environmental DNA6 detections

Where the DNA of Hymenodictyon parvifolium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 19.1–26.7

Seasonal swing summer↔winter8.80 °C

Max temp (day)28.7 °C 25.4–31.2

Min temp (night)18.2 °C 12.8–21.5

Precipitation53.6 mm/mo 30.2–73.8

Air humidity57.8 % 51.1–61.0

Moisture balance-102 mm/mo -109–-64.8

Vapour deficit1,320 Pa 963–1,480

Wind speed3.10 m/s 2.10–3.60

Cloud cover31.0 % 14.8–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)