Hymenocallis latifolia

(Mill.) M.Roem. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Hymenocallis

At a glance

Occurrence records306

Data sources12

Biological traits10

DNA specimens4

eDNA detections4

Sources12 archives

Databases and archives Hymenocallis latifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility302 records↗

OBISOcean Biodiversity Information System4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF · OBIS306 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 70

01Narrative

Hymenocallis latifolia (mangrove spider-lily or perfumed spider-lily) is a bulb-forming perennial that grows on beaches, sand dunes, mangrove swamps and other wetlands along the coasts of Florida, Mexico, and the West Indies (Cuba, Jamaica, Puerto Rico, Cayman Islands, Bahamas, etc.).Roemer, Max Joseph., Familiarum Naturalium Regni Vegetabilis Synopses Monographicae 4: 168. 1847. in LatinTropicos, Hymenocallis latifolia (Mill.) M. Roem.Kew World Checklist of Selected Plant FamiliesBiota of North America Program 2013 county distribution map It has showy white flowers and large green seeds up to 2.5 cm in diam. Common names include "mangrove spider-lily," "perfumed spider-lily," Flora of North America, v 26, p 292.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Hymenocallis latifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Amarylidaceae alkaloids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
(+)-Hippeastrine		present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenocallis latifolia has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes4

GenBank sequences5

eDNA detections4

The DNA barcodea real sequence read deposited for this species

ITSAF223516.1 ↗619 bp

ACGT

TCGAGCCCCGAACGGACGATCGCGAACTCGTAGAGCACCTATGGGGGGCAGCAACTGCCGTTCGCCATGGGTGCCCCAGCCGCCGTCGGC …

Hymenocallis latifolia internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hymenocallis latifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 70 n = 35

Ploidydiploid inferred

Chromosome records46–702n range58median70mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 462×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Flory, W. S. 1976. Distribution, chromosome numbers and types of various species and taxa of Hymenocallis. Nucleus 19: 204–227.

CCDB · book-ipcn75-78 — Flory 1976

2n 702×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Flory, W. S. 1975. Chromosome numbers for several species of Hymenocallis. Pl. Life 31: 56–63.

CCDB · ipcn-api-dl — Flory, W. S. 1976. Distribution, chromosome numbers and types of various species and taxa of Hymenocallis. Nucleus 19: 204–227.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.997 ↗

08Occurrence & distribution

Record type306 records

Wild obs. + sensor221

Museum / vouchered85

Range

Area of Occupancy AOO820 km²

Depth

0–200 m sunlit4

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 1 m · 4 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 130≤1 km 26≤10 km 20>10 km 4

180 georeferenced · 41 without coordinates

Open the mapobservation + sensor221

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 1≤1 km 3≤10 km 2>10 km 4

10 georeferenced · 75 without coordinates

Open the institutions mapphysical evidence85

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bronx, US	31
Tampa, US	23
University of Stellenboschlocation not on record	9
Kew, GB	7
Miami, US	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Saint Louis, US	2
Mississippi State, US	1
Dekalb, US	1

9 institutions · 83 of 85 vouchered records shown · 2 without an institution code

09Environmental DNA4 detections

Where the DNA of Hymenocallis latifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)