Hymenaea verrucosa

Gaertn. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Hymenaea

At a glance

Occurrence records1 572

Data sources10

Biological traits21

DNA specimens7

eDNA detections4

Sources10 archives

Databases and archives Hymenaea verrucosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 572 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS10 compounds

Occurrence & distributionGBIF1 572 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Hymenaea verrucosa est une espèce de plantes à fleurs de la famille des Fabaceae (légumineuses). Il appartient à la sous-famille des Detarioideae. C'est un grand arbre originaire des régions tropicales d'Afrique orientale et qui est cultivé dans de nombreuses régions du monde. L'espèce est actuellement considérée comme faisant partie du genre Hymenaea, mais certains auteurs l'isolent dans un genre monospécifique, Trachylobium, sous le nom Trachylobium verrucosum.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height17.5 m

Seed mass918 mg

Seed mass max1 127 mg

Seed mass min709 mg

Life cycle & reproduction5

Deciduousnessevergreen

Life formshrub or tree

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTdry evergreen forest

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnitrogen_fixer

Photosynthetic pathwayC3

Wood density732 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition10 compounds

Compounds documented for Hymenaea verrucosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Labdane diterpenoids $ Norlabdane diterpenoids3

Labdane diterpenoids3

Flavandiols (Leucoanthocyanidins)1

Chalcones1

Aurones1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-2-[(3,4-dihydroxyphenyl)methyl]-2,6-dihydroxy-1-benzofuran-3-one	present	LOTUS
(3R)-5-[(1R,4aS,5S,8aS)-5-(hydroxymethyl)-5,8a-dimethyl-2-methylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]-3-methylpent-1-en-3-ol	present	LOTUS
(3S)-5-[(1R,4aS,5S,8aS)-5-(hydroxymethyl)-5,8a-dimethyl-2-methylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]-3-methylpentan-1-ol	present	LOTUS
1-(2,4-Dihydroxyphenyl)-3-(3,4-dihydroxyphenyl)-2-hydroxyprop-2-en-1-one	present	LOTUS
5,6a,7,12a-Tetrahydroisochromeno[4,3-b]chromene-2,3,7,10-tetrol	present	LOTUS
methyl (1S,4aS,5R,8aS)-5-[(3S)-5-methoxy-3-methyl-5-oxopentyl]-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylate	present	LOTUS
methyl (3S)-5-[(1S,2R,4aR,8aR)-2-hydroxy-2,5,5,8a-tetramethyl-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]-3-methylpentanoate	present	LOTUS
methyl (E)-5-[(1R,4aS,5S,8aS)-5-(acetyloxymethyl)-5,8a-dimethyl-2-methylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]-3-methylpent-2-enoate	present	LOTUS
methyl (E)-5-[(1S,2R,4aR,8aR)-2-hydroxy-2,5,5,8a-tetramethyl-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]-3-methylpent-2-enoate	present	LOTUS
Methyl Copalate	present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenaea verrucosa has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences8

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLL08480.1 ↗348 bp

ACGT

ATGTCACCACAAACAGAAACGAAAGCAAAGGTTGGGTTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATCAA …

Hymenaea verrucosa ribulose 1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid gene for plastid product

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★rbcLatrnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Hymenaea verrucosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records16–242n range24median24mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 244×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Lee, Y. T. & J. H. Langenheim. 1975. Systematics of the genus Hymenaea L. (Leguminosae, Caesalpinioideae, Detarieae). Univ. Calif. Publ. Bot. 69: 1–109.

CCDB · book-ipcn75-78 — Lee & Langenheim 1975

CCDB · book-ipcn73-74 — LANGENHEIM, J., & Y.-T. Lee. 1974. Reinstatement of the genus Hymenae 1 (Leguminosae: Caesalpinioideae) in Africa. Brittonia 26: 3-21.

CCDB · book-ipcn73-74 — LEE, Y.-T., and J.H. LANGENHEIM. 1974. In IOPB chromosome number reports XLV. Taxon 23: 619-624.

2n 162×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Atchison 1951

CCDB · book-atlas-flowering-plants — Atchison 1951

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 572 records

Wild obs. + sensor124

Museum / vouchered435

Cultivated / captive21

Fossil991

Other1

Origin

Native1

Range

Area of Occupancy AOO808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 13≤1 km 1≤10 km 4>10 km 6

24 georeferenced · 100 without coordinates

Open the mapobservation + sensor124

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 4≤1 km 2≤10 km 5

11 georeferenced · 424 without coordinates

Open the institutions mapphysical evidence435

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy10% within 1 km

≤1 km 2≤10 km 19

21 georeferenced

Open the mapnot free-living21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	114
Saint Louis, US	75
Kew, GB	38
Plocation not on record	36
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	26
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	25
Instituto de Investigação Científica Tropicallocation not on record	20
Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record	8
TAFORI-LSRClocation not on record	7
University of Stellenboschlocation not on record	7
Glocation not on record	6
Bronx, US	5
Uppsala, SE	4
Eduardo Mondlane Universitylocation not on record	4
CJBGlocation not on record	4
Pretoria, ZA	3
MeiseBGlocation not on record	3
Centro de Biotecnologia e Quimica-CEBIQlocation not on record	2
Stockholm, SE	2
Auckland, NZ	1
JBRJlocation not on record	1
MAlocation not on record	1
HNBlocation not on record	1
BPRHlocation not on record	1
Arusha, TZ	1
DSMlocation not on record	1
Buffelskloof Private Nature Reserve, Herbariumlocation not on record	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

28 institutions · 398 of 435 vouchered records shown · 37 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Hymenaea verrucosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.1 °C 22.6–23.5

Seasonal swing summer↔winter17.2 °C

Max temp (day)28.5 °C 28.3–28.7

Min temp (night)17.7 °C 16.7–18.7

Precipitation71.8 mm/mo 29.2–114

Air humidity55.7 % 54.7–56.7

Moisture balance-76.7 mm/mo -101–-52.0

Vapour deficit1,247 Pa 1,239–1,256

Wind speed3.30 m/s 3.00–3.60

Cloud cover24.9 % 15.6–34.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hymenaea verrucosa

At a glance

Sources10 archives

Size & morphology4

Life cycle & reproduction5

Diet & foraging1

Habitat & environment7

Physiology & chemistry3

Other traits1

Compound class profile5 classes

Documented compounds10 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 572 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 28 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 572 records