Hymenaea courbaril
speciesAt a glance
Occurrence records7 671
Data sources15
Biological traits114
DNA specimens28
eDNA detections21
Sources15 archives
Databases and archives Hymenaea courbaril's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility7 671 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics28 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources114 traits
Chemical compositionLOTUS · NPASS49 compounds
Occurrence & distributionGBIF7 671 records
Environmental DNA1 datasets · 2 countries21 detections
DNA & barcodingBOLD · NCBI28 specimens
Genome at a glanceCCDB2n = 24
01Narrative
Hymenaea courbaril Hymenaea courbaril, the courbaril or West Indian locust, is a tree common in the Caribbean, Central America, and South America. It is a hardwood that is used for furniture, flooring, and decoration. Its hard fruit pods have edible dry pulp surrounding the seeds. Its sap, called animé, is used for incense, perfume, and varnish.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology12
Leaf size3 218 mm²
⚠ sources differ — TRY: 3 218 mm² · GIFT: 8 551 mm²
Plant height21.67 m
⚠ sources differ — GIFT: 21.67 m · USDA: 19.81 m · TRY: 17.01 m
Plant height max45 m
Seed length25.53 mm
⚠ sources differ — TRY: 25.53 mm · GIFT: 19.6 mm
Seed length max19.6 mm
Seed length min19.6 mm
Seed mass4 772 mg
⚠ sources differ — TRY: 4 772 mg · GIFT: 3 670 mg
Seed mass max5 418 mg
Seed mass min0.035 mg
Seed volume13 000 mm³
Seed volume max13 000 mm³
Seed volume min13 000 mm³
Life cycle & reproduction25
Bloom periodSummer
Coppice potentialNo
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dispersal typeanimal
Flower colourwhite
Flower conspicuousYes
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDASlow
Life formtree
Life spanperennial
Lifespan categoryShort
Pollination modebiotic
Pollination syndromebat
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Resprout abilityNo
Self fertilizationabsent
Diet & foraging1
Parasiteindependent
Habitat & environment28
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsNo
Aquaticterrestrial
BloatNone
Climatewet tropical
Climberself-supporting
Elevation max2 000 m
Elevation mean600 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterDense
Foliage textureCoarse
Fruit colourbrown
Growth formtree
Habitat GIFTFloresta Ciliar ou Galeria, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial)
Hedge toleranceLow
Known allelopathNo
Leaf retentionYes
Low growing grassNo
Mycorrhiza typeAMNM
Root depth min36 in
Shape and orientationErect
Small grainNo
Woodinesswoody
Physiology & chemistry25
Anaerobic toleranceLow
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Frost free days min365 days
Ldmc max340 mg/g
Ldmc min340 mg/g
Leaf C:N ratio24.84 g/g
Leaf c503 mg/g
Leaf dry-matter content (LDMC)432 mg/g
⚠ sources differ — TRY: 432 mg/g · GIFT: 340 mg/g
Leaf n19.23 mg/g
Nitrogen fixation levelLow
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max90 in
Precipitation min35 in
Salinity toleranceNone
Shade toleranceLow
Soil pH max7.5 pH
Soil pH min5.5 pH
Specific leaf area (SLA)16.06 mm²/mg
⚠ sources differ — TRY: 16.06 mm²/mg · GIFT: 15.09 mm²/mg
Temperature min40 °F
Wood density707 mg/cm³
⚠ sources differ — TRY: 707 mg/cm³ · GIFT: 860 mg/cm³
Uses & economy16
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productLow
Lumber productYes
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalLow
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound122 per lb
ToxicityNone
Veneer productYes
Other traits7
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousYes
Fruit seed persistenceYes
Height at 20yr9.14 m
Planting density max640 per acre
Planting density min320 per acre
03Chemical composition49 compounds
Compounds documented for Hymenaea courbaril across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Halimane diterpenoids9
Labdane diterpenoids $ Norlabdane diterpenoids6
Colensane and Clerodane diterpenoids4
Iridoids monoterpenoids4
Cinnamic acids and derivatives $ Phenylethanoids4
Documented compounds49 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Ursolic Acid | present | NPASS | |
| (-)-Arctigenin | present | NPASS | |
| (-)-Arctiin | present | NPASS | |
| (-)-Copalic acid | present | LOTUS | |
| (13R)-13-Hydroxy-1(10),14-Ent-Halimadien-18-Oic Acid | present | LOTUS | |
| (1S,3S,5S,6R,8aS)-3-hydroxy-5-[(3R)-3-hydroxy-3-methylpent-4-enyl]-1,5,6-trimethyl-2,3,6,7,8,8a-hexahydronaphthalene-1-carboxylic acid | present | LOTUS | |
| (1S,4aR,5R,8aS)-1,4a-dimethyl-6-methylidene-5-[(2E)-3-methylpenta-2,4-dienyl]-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | LOTUS | |
| (1S,4aS,5R,8aS)-1,4a-dimethyl-6-methylidene-5-[(2E)-3-methylpenta-2,4-dienyl]-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid | present | LOTUS | |
| (1S,4aS,7S,7aS)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-7-carboxylic acid | present | NPASS | |
| (1S,5S,6R,8aS)-5-[(3R)-3-hydroxy-3-methylpent-4-enyl]-1,5,6-trimethyl-3-oxo-6,7,8,8a-tetrahydro-2H-naphthalene-1-carboxylic acid | present | LOTUS |
05DNA & barcoding28 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenaea courbaril has left across the world's sequence archives.
At a glance
DNA specimens28
Marker genes5
GenBank sequences10
eDNA detections21
Countries3
The DNA barcodea real sequence read deposited for this species
GAACCTGCGGAAGGATCATTGTCGCCACCTCGCTCACGAGCAGCACGACCCGTGAACGCGTTCTGACTGAGCCCCGCACGCCGAGACTGG …
Hymenaea courbaril strain Hc86 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL2★rbcLa★ITS7★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Hymenaea courbaril carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidydiploid inferred
Chromosome records24–242n range24median24mode6records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 246×CCDB · book-ipcn73-74 · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · book-ipcn73-74 — LEE, Y.-T., and J.H. LANGENHEIM. 1974. In IOPB chromosome number reports XLV. Taxon 23: 619-624.
CCDB · book-ipcn73-74 — BANDEL, G. 1974. Chromosome numbers and evolution in the Leguminosae Caryologia 27: 17-32.
CCDB · book-fedorov — Atchison 1951
CCDB · book-fedorov — Berger C. A. et al. 1958
CCDB · book-atlas-flowering-plants — Atchison 1951
n 121×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — BAWA, K.S. 1973. Chromosome numbers of tree species of a lowland tropical community. J. Arnold Arbor. 54: 422-434.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~0.45 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0.45 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type7 671 records
Wild obs. + sensor4 488
Museum / vouchered3 043
Cultivated / captive8
Other132
Origin
Native987
Range
Area of Occupancy AOO10 280 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy79% within 1 km
≤100 m 303≤1 km 70≤10 km 51>10 km 50
474 georeferenced · 4 014 without coordinates
Open the mapobservation + sensor4 488
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy75% within 1 km
≤100 m 165≤1 km 31≤10 km 45>10 km 21
262 georeferenced · 2 781 without coordinates
Open the institutions mapphysical evidence3 043
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy67% within 1 km
≤100 m 2>10 km 1
3 georeferenced · 5 without coordinates
Open the mapnot free-living8
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions84 of 220 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 294 |
| Bronx, US | 195 |
| USP-IBlocation not on record | 170 |
| Laboratorio de Ictiologialocation not on record | 108 |
| Mexico City, MX | 90 |
| Kew, GB | 82 |
| Londrina, BR | 74 |
| Chicago, US | 72 |
| Empresas Públicas de Medellín E.S.P. (EPM)location not on record | 67 |
| Cenargenlocation not on record | 56 |
| Salvador, BR | 48 |
| Durango, MX | 48 |
| JBRJlocation not on record | 47 |
| Brasília, BR | 46 |
| Feira de Santana, BR | 45 |
| National Biodiversity Institute, Costa Ricalocation not on record | 42 |
| UnBlocation not on record | 42 |
| Santa Cruz de la Sierra, BO | 42 |
| UNICAMPlocation not on record | 39 |
| University of Stellenboschlocation not on record | 38 |
| UFMSlocation not on record | 37 |
| UNIVASFlocation not on record | 35 |
| Antiguo Cuscatlán, SV | 32 |
| Chaguaramas, TT | 29 |
| Museu Paraense Emílio Goeldilocation not on record | 29 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 29 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 27 |
| UFBAlocation not on record | 26 |
| Brasília, BR | 26 |
| Departamento de Sistematica e Ecologialocation not on record | 25 |
| Universidad de Antioquia (UdeA)location not on record | 24 |
| La Paz, BO | 24 |
| Berlin, DE | 23 |
| UEMAlocation not on record | 22 |
| Universidad Nacional de Colombia (UNAL)location not on record | 22 |
| Museum of Zoologylocation not on record | 21 |
| León, NI | 20 |
| MAlocation not on record | 20 |
| Paris, FR | 18 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 17 |
| South Kensington, GB | 17 |
| UFPIlocation not on record | 16 |
| CEPLAClocation not on record | 16 |
| UFMGlocation not on record | 16 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 16 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 16 |
| Istituto Agrario Castelnuovolocation not on record | 15 |
| Universidade Federal do Maranhãolocation not on record | 15 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 15 |
| Université de Bordeauxlocation not on record | 14 |
| Cuiabá, BR | 14 |
| ASUlocation not on record | 13 |
| Tuxtla Gutiérrez, MX | 13 |
| UNESP-ISlocation not on record | 13 |
| Ann Arbor, US | 13 |
| Ivano-Frankivsk, UA | 13 |
| Fortaleza, BR | 11 |
| UNESP-FCAlocation not on record | 11 |
| Bogotá, D.C., CO | 11 |
| Altos de Pipe, VE | 10 |
| UFSCarlocation not on record | 10 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 9 |
| San José, CR | 9 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 9 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 9 |
| Chapingo, MX | 9 |
| Fundación Desarrollo y Ambiente FUNDAlocation not on record | 8 |
| UNITINSlocation not on record | 8 |
| CASlocation not on record | 8 |
| UEPAlocation not on record | 8 |
| Mexico City, MX | 7 |
| UNESP-RClocation not on record | 7 |
| Area de Conservacion Guanacastelocation not on record | 7 |
| Masindi, UG | 7 |
| UFRPElocation not on record | 7 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 6 |
| CPATSAlocation not on record | 6 |
| Tuxtla Gutiérrez, MX | 6 |
| MEXUlocation not on record | 6 |
| Austin, US | 6 |
| URCAlocation not on record | 6 |
| Tapachula, MX | 6 |
| Ciudad de México, MX | 6 |
| Ural Federal University "B. N. Yeltsin"location not on record | 6 |
| UFVJMlocation not on record | 6 |
| UEMlocation not on record | 6 |
| Universidad Industrial de Santander (UIS)location not on record | 5 |
| UTFPR-CPlocation not on record | 5 |
| St. Augustine, TT | 5 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 5 |
| San Francisco, US | 5 |
| Universidade Federal do Oeste da Bahialocation not on record | 5 |
| INBIOlocation not on record | 5 |
| Universidade Federal de Sergipe (UFS)location not on record | 5 |
| COLlocation not on record | 5 |
| Porto Velho, BR | 4 |
| UESBlocation not on record | 4 |
| Universidade Paulistalocation not on record | 4 |
| Universidad Distrital Francisco José de Caldas (UDistrital)location not on record | 4 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 4 |
| ESALQlocation not on record | 4 |
| Austin, US | 4 |
| HNBlocation not on record | 4 |
| Riverside, US | 4 |
| UFPElocation not on record | 3 |
| FPMZBlocation not on record | 3 |
| Universidade de São Paulolocation not on record | 3 |
| Santarém, BR | 3 |
| Uberlândia, BR | 3 |
| Campo Mourão, BR | 3 |
| Mérida, MX | 3 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 3 |
| UNICAPlocation not on record | 3 |
| Fredericksburg, US | 3 |
| UFERSAlocation not on record | 3 |
| Porto Alegre, BR | 3 |
| UFAClocation not on record | 3 |
| Tampa, US | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| Provincia di Livornolocation not on record | 3 |
| UNIVILLElocation not on record | 3 |
| Stockholm, SE | 3 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 3 |
| Corrientes, AR | 3 |
| Chongqing Museumlocation not on record | 3 |
| Richmond, US | 3 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 2 |
| Jataí / Setor Industrial, BR | 2 |
| Foz do Iguaçu, BR | 2 |
| Philadelphia, US | 2 |
| Universidad de Caldas (UCaldas)location not on record | 2 |
| UFPRlocation not on record | 2 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 2 |
| IECOSlocation not on record | 2 |
| Universidad Católica de Oriente (UCO)location not on record | 2 |
| INMAlocation not on record | 2 |
| Yaoundé, CM | 2 |
| UTFPR-DVlocation not on record | 2 |
| Teresina, BR | 2 |
| UNISANTAlocation not on record | 2 |
| UFOPlocation not on record | 2 |
| HACAMlocation not on record | 2 |
| Universidad Nacional Federico Villarreallocation not on record | 2 |
| OTSlocation not on record | 2 |
| Guasave, MX | 2 |
| MeiseBGlocation not on record | 2 |
| LDlocation not on record | 2 |
| FUNEDlocation not on record | 2 |
| WCSlocation not on record | 2 |
| Cochabamba, BO | 2 |
| Blumenau, BR | 2 |
| Burlington, US | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Universidad de El Salvadorlocation not on record | 2 |
| Universidad del Valle (UniValle)location not on record | 2 |
| UFABClocation not on record | 2 |
| UNESP-IBILCElocation not on record | 2 |
| BMlocation not on record | 2 |
| Aarhus, DK | 2 |
| Universidad Autónoma de Madridlocation not on record | 2 |
| HUAlocation not on record | 2 |
| CJBGlocation not on record | 2 |
| HUENFlocation not on record | 2 |
| Santa Teresa, BR | 2 |
| Universidade Federal do Espírito Santolocation not on record | 2 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 2 |
| Montréal, CA | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Miami, US | 1 |
| Edinburgh, GB | 1 |
| IPA/SPlocation not on record | 1 |
| Universidad de San Carlos de Guatemalalocation not on record | 1 |
| Clemson, US | 1 |
| UTPLlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Universidad de Córdoba (UC)location not on record | 1 |
| La Paz, MX | 1 |
| Cambridge, US | 1 |
| Juriquilla, MX | 1 |
| UNESP-FCAVlocation not on record | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Universidad de los Llanos (UniLlanos)location not on record | 1 |
| MEDELlocation not on record | 1 |
| US | 1 |
| Kunming, CN | 1 |
| Durham, US | 1 |
| Elocation not on record | 1 |
| Pontifícia Universidade Católica do Paranálocation not on record | 1 |
| Pondicherry, IN | 1 |
| QCNElocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Quito, EC | 1 |
| EL PASO, US | 1 |
| Guatemala City, GT | 1 |
| Dekalb, US | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 1 |
| St. Paul, US | 1 |
| UERJlocation not on record | 1 |
| PUC-RIOlocation not on record | 1 |
| Universidad de Córdoba (UniCórdoba)location not on record | 1 |
| Lake Charles, US | 1 |
| Ciudad de México, MX | 1 |
| Santiago de Cali, CO | 1 |
| UFRRJlocation not on record | 1 |
| Madison, US | 1 |
| Zlocation not on record | 1 |
| Aké Assi L., (DAKAR), 1995.location not on record | 1 |
| University of Zhejianglocation not on record | 1 |
| UFSClocation not on record | 1 |
| Cruz das Almas, BR | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| NO DISPONIBLElocation not on record | 1 |
| Sucre, BO | 1 |
| Université du Lomélocation not on record | 1 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 1 |
| Mexico City, MX | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Cascavel, BR | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
220 institutions · 2 898 of 3 043 vouchered records shown · 143 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA21 detections
Where the DNA of Hymenaea courbaril was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found21
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 21 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.7 °C 24.9–26.6
Seasonal swing summer↔winter2.30 °C
Max temp (day)30.0 °C 26.7–30.4
Min temp (night)23.1 °C 22.0–23.5
Precipitation201 mm/mo 34.6–355
Air humidity65.4 % 61.8–70.9
Moisture balance66.9 mm/mo -147–206
Vapour deficit1,144 Pa 916–1,302
Wind speed2.90 m/s 1.20–4.30
Cloud cover30.7 % 15.5–39.1
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.