Hymenachne amplexicaulis
(Rudge) Nees · speciesAt a glance
Occurrence records5 506
Data sources11
Biological traits37
DNA specimens8
eDNA detections8
Sources11 archives
Databases and archives Hymenachne amplexicaulis's data was compiled from.
WikipediaWikimedia Foundation5 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility5 506 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics8 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources37 traits
Occurrence & distributionGBIF5 506 records
Environmental DNA1 datasets · 2 countries8 detections
DNA & barcodingBOLD · NCBI8 specimens
Genome at a glanceCCDB2n = 18
01Narrative
Hymenachne amplexicaulis, also known as West Indian marsh grass in the US, Olive hymenachne in Australia, and hereafter referred to as hymenachne, is New World species in the genus Hymenachne. Hymenachne is from the Greek hymen meaning "membrane" and achne meaning "chaff, glume, scale" and amplexicaulis is from Latin, literally "embracing the stem" or "stem-clasping. This freshwater species is native to the tropical and subtropical regions of the West Indies, Northern South America, and Central America.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology11
Leaf length225 mm
Leaf length max2.5 mm
Leaf length min1 mm
Leaf size2 993 mm²
Leaf width13.5 mm
Leaf width max128 mm
Leaf width min12 mm
Plant height2 m
⚠ sources differ — AusTraits: 2 m · TRY: 1.31 m
Plant height generative1.55 m
Plant height max3.5 m
Plant height min0.5 m
Life cycle & reproduction9
Deciduousnessn.d.
Dispersal typewind
Flowering timeyyyyyyyyyyyy
Life formperennial or helophyte
Life spanperennial
Lifeform raunkiaer detailedhelophyte
Pollination syndromewind
Resprouting capacityresprouts
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max1 000 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Herb
Habitat GIFTÁrea Antrópica, Campinarana, Campo de Várzea, Floresta Ciliar ou Galeria, Floresta de Igapó, Floresta de Várzea, Vegetação Aquática
Leaf compoundnesssimple
Leaf shapelinear narrowly_triangular
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)303 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)17.68 mm²/mg
05DNA & barcoding8 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hymenachne amplexicaulis has left across the world's sequence archives.
At a glance
DNA specimens8
Marker genes3
GenBank sequences7
eDNA detections8
Countries2
The DNA barcodea real sequence read deposited for this species
AGAGACTAAAGCAAGTGTTGGATTTAAAGCTGGTGTTAAGGATTATAAATTGACTTACTACACCCCGGAGTACGAAACCAAGGATACTGA …
Hymenachne amplexicaulis voucher J.R. Abbott 23713 (FLAS) ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL4★rbcLa
plant barcode
06Genome at a glanceCCDB
The complete instruction manual Hymenachne amplexicaulis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–362n range18median18mode18records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1810×CCDB · book-ipcn66 · CCDB · book-ipcn67-71 · CCDB · book-fedorov
CCDB · book-ipcn66 — Gould 1966
CCDB · book-ipcn67-71 — GOULD, F.W. 1968. Chromosome numbers of Texas grasses. Canad. J. Bot. 46: 1315-1325.
CCDB · book-fedorov — Brown W. V. 1948
CCDB · book-fedorov — Gould 1958, 1966
CCDB · book-fedorov — Church 1929b
CCDB · book-fedorov — Nielsen E. L. 1939
CCDB · book-fedorov — Brown W: V. 1948
CCDB · book-fedorov — Gould 1958
2n 207×CCDB · croinout · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · croinout — Pohl, R. W. & Davidse, G. 1971
CCDB · croinout — Honfi, A. I., Quarin, C. L. & Valls, J. F. M. 1990
CCDB · ipcn-api-dl — Pohl, R. W. & G. Davidse. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23(3): 293–324.
CCDB · ipcn-api-dl — Honfi, A. I., C. L. Quarin & J. F. M. Valls. 1990. Estudios cariologicos en Gramineas Sudamericanas. Darwiniana 30(1–4): 87–94.
CCDB · book-ipcn67-71 — POHL, R.W., & G. DAVIDSE. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23: 293-324.
CCDB · book-indian_vol2 — Mehra, P. N. & Chaudhary, J.D. 1974
2n 91×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — SPELLENBERG, R. 1970. In IOPB chromosome number reports xxv. Taxon 19: 102-113.
2n 361×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Narayan, K.N. & Sindhe, A.N.R. 1968; Sindhe, A.N.R. et al. 1975
n 922×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn67-71 +2
CCDB · ipcn-api-dl — Spellenberg, R. 1975a. Synthetic hybridization and taxonomy of western North America Dichanthelium, group Lanuginosa (Poaceae). Madroño 23: 134–153.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Spellenberg, R. 1975. Autogamy and hybridization as evolutionary mechanisms in Panicum subgenus Dicanthelium (Gramineae). Brittonia 27: 87–95.
CCDB · book-ipcn72 — DAVIDSE, G., & R.W. POHL. 1972. Chromosome numbers and notes on some Central American grasses. Canad. J. Bot. 50: 273-283.
CCDB · book-ipcn67-71 — SPELLENBERG, R. 1970. In IOPB chromosome number reports xxv. Taxon 19: 102-113.
CCDB · book-ipcn67-71 — SPELLENBERG, R.W. 1970. Panicum shastense (Gramineae), a sterile hybrid between E pacificum and E scribnerianum. Brittonia 22: 154-162.
CCDB · book-ipcn75-78 — Davidse & Pohl 1975
CCDB · book-ipcn75-78 — Davidse & Pohl 1978
CCDB · book-ipcn75-78 — Reeder 1977
CCDB · Cave1958 — Gould 1958
n 106×CCDB · croinout · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · croinout — Davidse, G. & Pohl, R. W. 1974
CCDB · croinout — Davidse, G. & Pohl, R. W. 1978
CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.
CCDB · book-ipcn75-78 — Davidse & Pohl 1978
CCDB · book-ipcn73-74 — DAVIDSE, G., & R.W. POHL. 1974. Chromosome numbers, meiotic behavior, and notes on tropical American grasses (Gramineae). Canad. J. Bot. 52: 317-328.
CCDB · book-ipcn73-74 — MEHRA, P.N., & J.D. CHAUDHARY. 1974. In IOPB chromosome number reporl XLVI. Taxon 23: 801-812.
n 181×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sharma, C. B., B. N. Behera & S. K. Dash. 1978. A cytological study of some grasses from Orissa, an eastern coastal belt of India. Proc. Indian Acad. Sci. 87B 11: 355–360.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~14.3 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin14.3 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type5 506 records
Wild obs. + sensor2 466
Museum / vouchered2 414
Other626
Origin
Native321
Introduced49
Range
Area of Occupancy AOO8 984 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy95% within 1 km
≤100 m 907≤1 km 28≤10 km 21>10 km 29
985 georeferenced · 1 481 without coordinates
Open the mapobservation + sensor2 466
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy80% within 1 km
≤100 m 412≤1 km 25≤10 km 95>10 km 16
548 georeferenced · 1 866 without coordinates
Open the institutions mapphysical evidence2 414
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions91 of 205 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Saint Louis, US | 355 |
| Durango, MX | 155 |
| Brisbane, AU | 114 |
| Bronx, US | 105 |
| Mexico City, MX | 103 |
| University of Stellenboschlocation not on record | 82 |
| UFMSlocation not on record | 55 |
| San Isidro, AR | 54 |
| Kew, GB | 50 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 47 |
| Palmerston, AU | 46 |
| Paleontological Collectionlocation not on record | 44 |
| Tampa, US | 40 |
| National Biodiversity Institute, Costa Ricalocation not on record | 36 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 36 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 35 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 29 |
| Fortaleza, BR | 26 |
| UNIVASFlocation not on record | 22 |
| Xiamen, CN | 22 |
| Canberra, AU | 22 |
| Glocation not on record | 22 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 21 |
| Laboratorio de Ictiologialocation not on record | 20 |
| St. Augustine, TT | 20 |
| Université de Bordeauxlocation not on record | 19 |
| Corrientes, AR | 19 |
| Brasília, BR | 19 |
| Universidad Nacional de Colombia (UNAL)location not on record | 18 |
| CJBGlocation not on record | 18 |
| Mount Annan, AU | 18 |
| Ann Arbor, US | 17 |
| UEMlocation not on record | 17 |
| Universidad Nacional de Asunciónlocation not on record | 17 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 16 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 15 |
| South Kensington, GB | 14 |
| Aarhus, DK | 14 |
| Antiguo Cuscatlán, SV | 13 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 13 |
| Embrapa Amazônia Oriental, Ministry of Agriculturelocation not on record | 12 |
| Brasília, BR | 12 |
| León, NI | 12 |
| Cenargenlocation not on record | 12 |
| Feira de Santana, BR | 11 |
| Museu Paraense Emílio Goeldilocation not on record | 11 |
| Ciudad Autónoma de Buenos Aires, AR | 10 |
| Universidade Federal do Maranhãolocation not on record | 10 |
| Austin, US | 10 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 10 |
| Smithfield, AU | 10 |
| Centro de Estudios y Colecciones Biológicas para la Conservaciónlocation not on record | 9 |
| JBRJlocation not on record | 9 |
| CASlocation not on record | 9 |
| UnBlocation not on record | 8 |
| Altos de Pipe, VE | 8 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 8 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 7 |
| Museo Entomologico de Leonlocation not on record | 7 |
| Salvador, BR | 7 |
| Mérida, MX | 7 |
| IPA/SPlocation not on record | 7 |
| Universidade Federale do Rio Grande do Sullocation not on record | 6 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 6 |
| California Academy of Scienceslocation not on record | 6 |
| Chicago, US | 6 |
| UNITINSlocation not on record | 6 |
| Culiacán, MX | 6 |
| Jena Microbial Resource Collectionlocation not on record | 6 |
| San Francisco de Campeche, MX | 6 |
| BMlocation not on record | 5 |
| Autlán de Navarro, MX | 5 |
| Berlin, DE | 5 |
| Taipei, TW | 5 |
| Durham, US | 5 |
| US | 5 |
| UFERSAlocation not on record | 5 |
| Zapopan, MX | 5 |
| MEXUlocation not on record | 4 |
| CEPLAClocation not on record | 4 |
| Masindi, UG | 4 |
| Austin, US | 4 |
| La Paz, BO | 4 |
| UEMAlocation not on record | 4 |
| Torreón, MX | 4 |
| UFBAlocation not on record | 4 |
| San José, CR | 4 |
| Santa Cruz de la Sierra, BO | 4 |
| Ciudad de México, MX | 4 |
| Santarém, BR | 3 |
| Collections de la Faculte des Sciences de Lyonlocation not on record | 3 |
| James Cook Townsvillelocation not on record | 3 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 3 |
| MAlocation not on record | 3 |
| Fort Worth, US | 3 |
| Universidade Federal de Sergipe (UFS)location not on record | 3 |
| Universidad del Quindío (UniQuindío)location not on record | 3 |
| UFMGlocation not on record | 3 |
| Miami, US | 3 |
| UFRPElocation not on record | 3 |
| Universidad de Córdoba (UC)location not on record | 3 |
| Mexico City, MX | 3 |
| Chapingo, MX | 3 |
| Bloomington, US | 2 |
| UNICAMPlocation not on record | 2 |
| UFPRlocation not on record | 2 |
| Federal University of Espírito Santolocation not on record | 2 |
| Blumenau, BR | 2 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Madison, US | 2 |
| Cuiabá, BR | 2 |
| UFPIlocation not on record | 2 |
| PUC-RSlocation not on record | 2 |
| International Salmonella Centre (W.H.O.)location not on record | 2 |
| Chaguaramas, TT | 2 |
| Castelar, AR | 2 |
| Dekalb, US | 2 |
| Valdosta State Universitylocation not on record | 2 |
| Columbia, US | 2 |
| Maringá, BR | 2 |
| QCNElocation not on record | 2 |
| Universidad de El Salvadorlocation not on record | 2 |
| USP-IBlocation not on record | 2 |
| Mérida, MX | 2 |
| Riverside, US | 2 |
| UFESlocation not on record | 2 |
| VENlocation not on record | 2 |
| Londrina, BR | 2 |
| Burlington, US | 2 |
| Universidad de los Andes (UniAndes)location not on record | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| TAIElocation not on record | 2 |
| UNESP, Campus São José Rio Prêtolocation not on record | 2 |
| MeiseBGlocation not on record | 1 |
| Cambridge, US | 1 |
| Bangkok, TH | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Santiago de Cali, CO | 1 |
| PUC-RIOlocation not on record | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Auckland, NZ | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Guangzhou, CN | 1 |
| OTSlocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Foz do Iguaçu, BR | 1 |
| Montréal, CA | 1 |
| Córdoba, AR | 1 |
| FUVATESlocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Tapachula, MX | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Sucre, BO | 1 |
| Universidad de Córdoba (UniCórdoba)location not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Lima, PE | 1 |
| Sociedad Para el Estudio de los Recursos Bioticos de Oaxacalocation not on record | 1 |
| Durham, US | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Institut de Biologia Evolutiva, (CSIC-UPF)location not on record | 1 |
| Cochabamba, BO | 1 |
| Guilin, CN | 1 |
| Sociedad para el Estudio de los Recursos Bióticos de Oaxaca, A. C.location not on record | 1 |
| Universidad Nacional del Litorallocation not on record | 1 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 1 |
| UFAClocation not on record | 1 |
| Universidade Paulistalocation not on record | 1 |
| San Angelo, US | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| Station d'Ecologie de Lamtolocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| Armidale, AU | 1 |
| UTFPR-CPlocation not on record | 1 |
| Cusco, PE | 1 |
| UNEMATlocation not on record | 1 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 1 |
| WTUlocation not on record | 1 |
| Hobart, AU | 1 |
| UNESP-FCAlocation not on record | 1 |
| Philadelphia, US | 1 |
| XALlocation not on record | 1 |
| IAvHlocation not on record | 1 |
| Mexico City, MX | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| UFSClocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| GAlocation not on record | 1 |
| Ciudad de México, MX | 1 |
| FAVElocation not on record | 1 |
| Campo Mourão, BR | 1 |
| Universidade de São Paulolocation not on record | 1 |
| ASUlocation not on record | 1 |
| PRClocation not on record | 1 |
| Porto Velho, BR | 1 |
| UFPElocation not on record | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| UEPAlocation not on record | 1 |
| Iquitos, PE | 1 |
| Uberlândia, BR | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Fundación Estación Biológica Guayacanallocation not on record | 1 |
| arosemena tola, EC | 1 |
| Edinburgh, GB | 1 |
205 institutions · 2 321 of 2 414 vouchered records shown · 92 without an institution code
09Environmental DNA8 detections
Where the DNA of Hymenachne amplexicaulis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found8
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 8 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median26.8 °C 25.8–27.8
Seasonal swing summer↔winter3.20 °C
Max temp (day)30.0 °C 28.4–31.5
Min temp (night)23.2 °C 22.8–23.5
Precipitation79.5 mm/mo 33.3–126
Air humidity58.1 % 56.7–59.4
Moisture balance-64.6 mm/mo -109–-20.1
Vapour deficit1,473 Pa 1,433–1,513
Wind speed2.20 m/s 2.20–2.30
Cloud cover33.7 % 29.8–37.6
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.