Hylotelephium telephioides

(Michx.) H.Ohba · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Hylotelephium

At a glance

Occurrence records999

Data sources11

Biological traits9

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Hylotelephium telephioides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility999 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF999 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 24

01Narrative

Hylotelephium telephioides is a flowering plant in the stonecrop family Crassulaceae. Its common names include Allegheny stonecrop and live-forever. Its native range in the USA extends from Georgia to Illinois and New York, and it has introduced populations in Ontario. In the wild, it is found on rock outcrops, especially at moderate to high elevations.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hylotelephium telephioides has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences2

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG234978.1 ↗345 bpCanada · 2013

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGTATT …

Hylotelephium telephioides voucher CCDB-24915-B07 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hylotelephium telephioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Ploidydiploid inferred

Chromosome records24–242n range24median24mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 242×CCDB · eflora · CCDB · book-atlas-flowering-plants

CCDB · eflora

CCDB · book-atlas-flowering-plants — Baldwin 1937

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type999 records

Wild obs. + sensor867

Museum / vouchered130

Cultivated / captive1

Other1

Range

Area of Occupancy AOO1 520 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 476≤1 km 69≤10 km 40>10 km 132

717 georeferenced · 150 without coordinates

Open the mapobservation + sensor867

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 12≤1 km 30≤10 km 50>10 km 5

97 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence130

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chongqing Museumlocation not on record	31
Chicago, US	26
University of Stellenboschlocation not on record	12
St. Paul, US	11
Lord Fairfax Community Collegelocation not on record	7
College Park, US	6
Western Carolina Universitylocation not on record	6
Chapel Hill, US	6
Bloomington, US	3
Harrisonburg, US	3
Norfolk, US	3
Wuzhou, CN	3
Durham, US	2
Millersville, US	2
University of British Columbia, Herbariumlocation not on record	1
Fairfax, US	1
Asheville, US	1
Clemson, US	1
Morgantown, US	1
Maryland Department of Natural Resourceslocation not on record	1
University of Southern Mississippilocation not on record	1
Ann Arbor, US	1

22 institutions · 129 of 130 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Hylotelephium telephioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

granite outcropgravelly margin of roadside pullover with Br…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 18.0–18.0

Seasonal swing summer↔winter24.4 °C

Max temp (day)24.2 °C

Min temp (night)10.8 °C

Precipitation54.9 mm/mo

Air humidity49.6 %

Moisture balance-83.1 mm/mo

Vapour deficit1,057 Pa

Wind speed1.20 m/s

Cloud cover32.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)